ID: 935756985

View in Genome Browser
Species Human (GRCh38)
Location 2:106283922-106283944
Sequence CTCCCACAGGAGGAGACAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935756979_935756985 2 Left 935756979 2:106283897-106283919 CCCAGAGGAGGTGATGCCAAGCA No data
Right 935756985 2:106283922-106283944 CTCCCACAGGAGGAGACAGGAGG No data
935756980_935756985 1 Left 935756980 2:106283898-106283920 CCAGAGGAGGTGATGCCAAGCAA No data
Right 935756985 2:106283922-106283944 CTCCCACAGGAGGAGACAGGAGG No data
935756976_935756985 23 Left 935756976 2:106283876-106283898 CCTGGGAGGCAGGGAAAGGTGCC No data
Right 935756985 2:106283922-106283944 CTCCCACAGGAGGAGACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935756985 Original CRISPR CTCCCACAGGAGGAGACAGG AGG Intergenic