ID: 935756990

View in Genome Browser
Species Human (GRCh38)
Location 2:106283939-106283961
Sequence AGGAGGAGGTGCTCATGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935756986_935756990 -8 Left 935756986 2:106283924-106283946 CCCACAGGAGGAGACAGGAGGAG No data
Right 935756990 2:106283939-106283961 AGGAGGAGGTGCTCATGAGAGGG No data
935756979_935756990 19 Left 935756979 2:106283897-106283919 CCCAGAGGAGGTGATGCCAAGCA No data
Right 935756990 2:106283939-106283961 AGGAGGAGGTGCTCATGAGAGGG No data
935756980_935756990 18 Left 935756980 2:106283898-106283920 CCAGAGGAGGTGATGCCAAGCAA No data
Right 935756990 2:106283939-106283961 AGGAGGAGGTGCTCATGAGAGGG No data
935756987_935756990 -9 Left 935756987 2:106283925-106283947 CCACAGGAGGAGACAGGAGGAGG No data
Right 935756990 2:106283939-106283961 AGGAGGAGGTGCTCATGAGAGGG No data
935756983_935756990 3 Left 935756983 2:106283913-106283935 CCAAGCAAACTCCCACAGGAGGA No data
Right 935756990 2:106283939-106283961 AGGAGGAGGTGCTCATGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935756990 Original CRISPR AGGAGGAGGTGCTCATGAGA GGG Intergenic