ID: 935765744

View in Genome Browser
Species Human (GRCh38)
Location 2:106366274-106366296
Sequence CGTGCTCTGCTGCAGCCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935765744_935765751 11 Left 935765744 2:106366274-106366296 CCCTGAGGCTGCAGCAGAGCACG No data
Right 935765751 2:106366308-106366330 GTGCAGAGCTCAGGTTGCTGGGG No data
935765744_935765752 15 Left 935765744 2:106366274-106366296 CCCTGAGGCTGCAGCAGAGCACG No data
Right 935765752 2:106366312-106366334 AGAGCTCAGGTTGCTGGGGAAGG No data
935765744_935765749 9 Left 935765744 2:106366274-106366296 CCCTGAGGCTGCAGCAGAGCACG No data
Right 935765749 2:106366306-106366328 CTGTGCAGAGCTCAGGTTGCTGG No data
935765744_935765748 2 Left 935765744 2:106366274-106366296 CCCTGAGGCTGCAGCAGAGCACG No data
Right 935765748 2:106366299-106366321 CAAGACGCTGTGCAGAGCTCAGG No data
935765744_935765750 10 Left 935765744 2:106366274-106366296 CCCTGAGGCTGCAGCAGAGCACG No data
Right 935765750 2:106366307-106366329 TGTGCAGAGCTCAGGTTGCTGGG No data
935765744_935765753 20 Left 935765744 2:106366274-106366296 CCCTGAGGCTGCAGCAGAGCACG No data
Right 935765753 2:106366317-106366339 TCAGGTTGCTGGGGAAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935765744 Original CRISPR CGTGCTCTGCTGCAGCCTCA GGG (reversed) Intergenic
No off target data available for this crispr