ID: 935773662

View in Genome Browser
Species Human (GRCh38)
Location 2:106450768-106450790
Sequence GTCTCTGCCTCCTGAATAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129659
Summary {0: 7, 1: 9, 2: 564, 3: 12266, 4: 116813}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935773662_935773666 8 Left 935773662 2:106450768-106450790 CCACCTATTCAGGAGGCAGAGAC 0: 7
1: 9
2: 564
3: 12266
4: 116813
Right 935773666 2:106450799-106450821 CACTTGAACCCAGGAGGCAGAGG 0: 9186
1: 33764
2: 74834
3: 112568
4: 133392
935773662_935773664 -1 Left 935773662 2:106450768-106450790 CCACCTATTCAGGAGGCAGAGAC 0: 7
1: 9
2: 564
3: 12266
4: 116813
Right 935773664 2:106450790-106450812 CAAGAGAATCACTTGAACCCAGG 0: 1769
1: 42452
2: 114404
3: 164204
4: 204515
935773662_935773665 2 Left 935773662 2:106450768-106450790 CCACCTATTCAGGAGGCAGAGAC 0: 7
1: 9
2: 564
3: 12266
4: 116813
Right 935773665 2:106450793-106450815 GAGAATCACTTGAACCCAGGAGG 0: 21628
1: 64917
2: 122797
3: 157734
4: 166761

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935773662 Original CRISPR GTCTCTGCCTCCTGAATAGG TGG (reversed) Intronic
Too many off-targets to display for this crispr