ID: 935777474

View in Genome Browser
Species Human (GRCh38)
Location 2:106486566-106486588
Sequence CCCTTGGAGGGCTGCGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 2, 1: 0, 2: 2, 3: 27, 4: 322}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935777474_935777482 -5 Left 935777474 2:106486566-106486588 CCTCTCCCGCAGCCCTCCAAGGG 0: 2
1: 0
2: 2
3: 27
4: 322
Right 935777482 2:106486584-106486606 AAGGGGTCCCTCTCCCCTGCAGG 0: 2
1: 0
2: 0
3: 15
4: 194
935777474_935777488 17 Left 935777474 2:106486566-106486588 CCTCTCCCGCAGCCCTCCAAGGG 0: 2
1: 0
2: 2
3: 27
4: 322
Right 935777488 2:106486606-106486628 GCTGCATGCCCAGTTCTCCCTGG 0: 2
1: 0
2: 1
3: 35
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935777474 Original CRISPR CCCTTGGAGGGCTGCGGGAG AGG (reversed) Intergenic
900314803 1:2051271-2051293 CCCTTGCCTGGCTGTGGGAGGGG + Intronic
900365379 1:2309869-2309891 ACCCTGGTGGGCTGAGGGAGGGG - Exonic
900475088 1:2872323-2872345 CTCTGGCAGGGGTGCGGGAGGGG + Intergenic
900605299 1:3521132-3521154 CCCTGGCAGGCCTGGGGGAGGGG + Intronic
901634650 1:10664935-10664957 CCCAGGGAGGGCTCCTGGAGTGG - Intronic
902304731 1:15527100-15527122 CTCTCGGAGGGCGGCGGGGGAGG + Intronic
902899449 1:19504171-19504193 TACTTGGGGGGCTGCGGCAGGGG - Intergenic
903175982 1:21580935-21580957 TACTTGGAGGGCTGAGGGGGAGG + Intergenic
903344841 1:22677385-22677407 CCCTTGTAGGGGTGTGGGAAGGG - Intergenic
903829134 1:26164445-26164467 CCGCCAGAGGGCTGCGGGAGAGG + Intergenic
904335428 1:29794151-29794173 GCCTTGGGGGCCTGAGGGAGGGG - Intergenic
904471801 1:30740881-30740903 CCCTTGCAGGGCCGGAGGAGTGG - Intronic
904997010 1:34639187-34639209 TCCTTGGAGGGCTGTGAGGGAGG - Intergenic
905741318 1:40373896-40373918 CCCTTGGCGGGCTTAGGGACAGG - Exonic
905862740 1:41361833-41361855 CCCGGGGAGGCCCGCGGGAGGGG - Intergenic
906045938 1:42830887-42830909 GCCTGGGAGCGCTGCGGGAATGG - Exonic
908382386 1:63609015-63609037 CCATTGGAAGGCAGAGGGAGGGG + Intronic
909628595 1:77747362-77747384 TGCTTGGAAGGCTGCGGCAGTGG - Intronic
914738073 1:150437687-150437709 CACTTGGAGGGCTGAGGTGGGGG - Intronic
915136775 1:153737606-153737628 CTCTTGGAAGGCTGAGGCAGAGG - Intronic
917500034 1:175577574-175577596 GGCTTGGAGGGCTGGGGGTGCGG + Intronic
919782664 1:201230901-201230923 CCCTTGGAGGCCTGGGACAGTGG + Intergenic
919945331 1:202315058-202315080 CCCTTGGGTGGCTGCTTGAGGGG + Intronic
921023529 1:211258458-211258480 CGCTTGGAGCGCTGGGGGAGAGG - Intronic
922088530 1:222373691-222373713 CCCTCAGAGGGCTGCTGTAGGGG - Intergenic
924381720 1:243471511-243471533 CCCGTGGAGGGCCGAGGGAGAGG - Intronic
1063309446 10:4938495-4938517 CCCTGGGAGGACAGTGGGAGAGG + Intronic
1065973403 10:30822636-30822658 CCCTTGGAGGGATTCAGAAGGGG - Intronic
1066295634 10:34051728-34051750 CCCTTGGGGGGCAGCAGTAGGGG + Intergenic
1067085930 10:43238085-43238107 CCTTTGGGGGGCGGAGGGAGGGG + Intronic
1067278626 10:44855027-44855049 CCCATGGGGGCCTGCAGGAGGGG + Intergenic
1069557419 10:69407321-69407343 CCCTCGGAGGGCTGGGGCTGGGG - Intronic
1072184058 10:93017477-93017499 TACTTGGGGGGCTGCGGCAGGGG + Intronic
1072630214 10:97140399-97140421 CCCAAGGAGGGCGGTGGGAGGGG - Intronic
1073180547 10:101580463-101580485 CCCTTGTACTGCTGTGGGAGAGG - Intronic
1073435590 10:103513875-103513897 CCGGGGGAGGGCTGTGGGAGAGG + Intronic
1073479351 10:103776599-103776621 CCCTCTGAGGGCTGTGAGAGAGG + Intronic
1074048393 10:109860456-109860478 GACTGGGAGGGCTGCGAGAGGGG - Intergenic
1074197977 10:111206107-111206129 CCCTTGAAGGGCGGCAGAAGAGG + Intergenic
1074270838 10:111952052-111952074 CCCCTGAAGGGCTGCAGAAGGGG - Intergenic
1074472009 10:113735792-113735814 CCCTTGCAGATCTGCAGGAGTGG + Intergenic
1074486751 10:113891707-113891729 CCCTGGGACGGCTGCAAGAGTGG - Intronic
1075829524 10:125394450-125394472 CCTTTGGGAGGCTGAGGGAGTGG + Intergenic
1076179789 10:128398237-128398259 CACATGGAAGGCTGCGTGAGTGG - Intergenic
1076458075 10:130617689-130617711 CCCTTGGTGGGCTCCTGGATAGG + Intergenic
1076760959 10:132605466-132605488 CCCTTGGAGGGATGGGGAAGGGG + Intronic
1077063436 11:627326-627348 CCCTCGGCCGGCTGGGGGAGGGG + Intergenic
1077089348 11:771416-771438 CACACAGAGGGCTGCGGGAGCGG + Exonic
1077096322 11:800634-800656 CCCTTCGGCGGCTGCTGGAGCGG - Exonic
1077982640 11:7315957-7315979 CCTTTGGATGGCCACGGGAGAGG + Intronic
1078656649 11:13246931-13246953 CCCTTGGAGGGGTGGGGCTGGGG - Intergenic
1081744582 11:45463969-45463991 CCCTTGCAGGGCTGTGGCAGTGG - Intergenic
1081863795 11:46348583-46348605 CATTTGGAGTGCTGGGGGAGGGG - Intronic
1081891137 11:46543178-46543200 TCCGTGGAGGGCTGAGGGGGAGG + Intronic
1083404300 11:62446080-62446102 CCCAGGGAGGGATGCAGGAGGGG + Intronic
1083608954 11:63996042-63996064 CCCCAGGAGGGCTGCGGGCAAGG + Intronic
1084103870 11:66967951-66967973 ACCTTGGAGGGCAGCAGGGGTGG - Intergenic
1084169170 11:67392217-67392239 CCCTTGGAGGACGGGGTGAGGGG + Exonic
1085389873 11:76176854-76176876 CCCTTGCAGGCCTGCGGCCGAGG + Intergenic
1086170801 11:83834297-83834319 CCTATGGAGGGCTGACGGAGAGG + Intronic
1089072441 11:115710905-115710927 CCCTTGGTGGGCTGAGGAAGTGG + Intergenic
1089295575 11:117465268-117465290 CCTTTGAAGGGCTGGGGCAGAGG - Intronic
1089677577 11:120100097-120100119 CCCTGGGTGGGGTGGGGGAGAGG - Intergenic
1090327770 11:125904167-125904189 CGCCTGGAGGGCTGTGTGAGCGG + Intronic
1090329356 11:125918484-125918506 GCCCTGGAGGACTGAGGGAGAGG + Intronic
1090393268 11:126403135-126403157 CCCTTGTGGGGCTGAGGGTGAGG - Intronic
1090396015 11:126418790-126418812 GCCTTGGAAGGCTGGGAGAGTGG + Intronic
1091223860 11:133946351-133946373 CCCATGGAGGGCAGCTGGTGGGG - Intronic
1091787682 12:3252796-3252818 CCTTTGCAGGGCTGAGTGAGCGG + Intronic
1092114365 12:5988383-5988405 GCCTCGGAGGGCTGGGGCAGGGG + Intronic
1093057949 12:14573375-14573397 CCCTCTGAGCCCTGCGGGAGTGG + Intergenic
1095800737 12:46268485-46268507 CCCGGGGAGGGCTGGGCGAGCGG - Intronic
1096178276 12:49537570-49537592 GCCTTGAACGGCTGGGGGAGGGG + Intergenic
1097974563 12:65670772-65670794 CCCTTGGAAGGCTCTAGGAGAGG + Intergenic
1100338975 12:93660029-93660051 CCCTGGGAGGACTGAGAGAGAGG - Intergenic
1101411648 12:104473662-104473684 CCCTTCCTGGGCTGTGGGAGAGG + Intronic
1101965854 12:109281499-109281521 CCCATGGCGGGGTGGGGGAGCGG + Exonic
1102466079 12:113131507-113131529 CCCATGGAGGGCTGAGGAATGGG - Intronic
1102952957 12:117042281-117042303 TCCCTGGGGGGCTGGGGGAGGGG - Intronic
1103189844 12:118991961-118991983 CACGTGGAGGGCTGAGGGATAGG + Intronic
1103555749 12:121765518-121765540 CCCTTGGTGGTCTGAGGCAGGGG + Intronic
1103706842 12:122879492-122879514 CACTTCCAGGCCTGCGGGAGGGG - Intronic
1104721566 12:131047447-131047469 TCCCTGGATGGCTGCGGAAGGGG - Intronic
1105294644 13:19076903-19076925 CTCTTGCAGGGCCCCGGGAGGGG - Intergenic
1106071130 13:26412229-26412251 CACTTGGAGGGGTGCATGAGAGG - Intergenic
1106161083 13:27201901-27201923 GACATGGAGGGCTGGGGGAGAGG + Intergenic
1112498602 13:99925148-99925170 CACCTGGAGGGCTGTGGGTGGGG - Intergenic
1113979563 13:114262671-114262693 CCCTTGGCCGGCGGAGGGAGTGG + Intronic
1114460534 14:22883592-22883614 CCCTGGGAGTGCTGGGGGAGGGG - Intronic
1115645553 14:35366542-35366564 CCAGTGGAGGGCTGTGGAAGAGG - Intergenic
1118575996 14:67241585-67241607 CCCTGGGAGCGCGGCGGGGGAGG + Intronic
1122309913 14:100787936-100787958 GGCTTGCAGGGCTGCGGGAGGGG - Intergenic
1122415317 14:101546875-101546897 CCCTTGCAGGCCTGCTGGGGGGG + Intergenic
1122657779 14:103273687-103273709 CCCTAGGAGGGCCGCGGGAAGGG - Intergenic
1122775211 14:104113930-104113952 CCCTTGGAGGGCCTTGGGAGAGG + Exonic
1122861973 14:104586789-104586811 GCCATGGAGGGCTGTGGAAGAGG + Intronic
1122863738 14:104594304-104594326 CCCTTGGAGGGCTCCTGGCCAGG + Intronic
1122953435 14:105058910-105058932 GCTTTGCAGGGCTGTGGGAGAGG - Intronic
1123505984 15:20941608-20941630 CCCATGGCGGGGTGCGGGTGGGG + Intergenic
1123563216 15:21515315-21515337 CCCATGGCGGGGTGCGGGTGGGG + Intergenic
1123599465 15:21952598-21952620 CCCATGGCGGGGTGCGGGTGGGG + Intergenic
1124899452 15:33808842-33808864 CCCTTGGACAGCAGTGGGAGGGG - Intronic
1125519545 15:40340276-40340298 TCCCTGGAGAGCTGGGGGAGGGG - Intronic
1129258458 15:74348053-74348075 TCCCTGGAGGGGTGGGGGAGAGG + Exonic
1129373222 15:75110742-75110764 CACAGGGAGGGCAGCGGGAGGGG + Intronic
1129411822 15:75354565-75354587 CCCTAAGAGGGCGGGGGGAGTGG + Intronic
1129882608 15:79017032-79017054 CCCTTGCTGGGCTCAGGGAGGGG + Intronic
1130380938 15:83371919-83371941 GCCTTAGAGGGGTGGGGGAGTGG + Intergenic
1130601893 15:85281238-85281260 TCCTAGGAGGGCCGGGGGAGGGG - Intergenic
1131133266 15:89913302-89913324 CCATTGTAGGGCCGCGGGCGGGG - Intergenic
1131547595 15:93328921-93328943 CCCTTGGGAGGCTGAGGCAGGGG + Intergenic
1131923929 15:97361370-97361392 TCCTTGGAGGGCTTCAGGAAGGG + Intergenic
1202971568 15_KI270727v1_random:242449-242471 CCCATGGCGGGGTGCGGGTGGGG + Intergenic
1132651734 16:1024254-1024276 CCCTGGCAGGGCCCCGGGAGAGG + Intergenic
1134040877 16:11067400-11067422 CCATTTGAGGGCTGCAGGGGGGG + Intronic
1134220069 16:12346789-12346811 CTCTTGGAGGGCTGTTGTAGGGG + Intronic
1136399495 16:30010016-30010038 CCCAAGGAGGGCTGCAGGGGGGG + Exonic
1137613630 16:49834882-49834904 GCCCAGGAGGGCTGGGGGAGGGG + Intronic
1138005786 16:53336046-53336068 GCTTTGGAAGGCTGAGGGAGAGG - Intergenic
1138297931 16:55902507-55902529 CCGTGGGAGGGATGTGGGAGAGG + Intronic
1138521690 16:57574916-57574938 CCCTGCGCAGGCTGCGGGAGCGG + Exonic
1139612631 16:68069887-68069909 CTCTTGGAGGCCTGCAGGGGAGG - Intronic
1139832484 16:69811196-69811218 TCCTGGGAGAGCTGCAGGAGTGG - Intronic
1141219072 16:82052190-82052212 TCCTTGGTGGGCTGTGGGAATGG + Intronic
1141713842 16:85715876-85715898 CTCTTGAAGGGCTGCGTGTGAGG + Intronic
1142364196 16:89641206-89641228 CCTCCGGAGGGCTGCGGGGGGGG + Intergenic
1143747175 17:9003264-9003286 GCCTCGGAGGGCAGCTGGAGCGG + Intergenic
1144479527 17:15617431-15617453 GCCTTGGAGGGGTCCAGGAGTGG - Intronic
1144778584 17:17796862-17796884 CCCCTGGAAGGCTGCCCGAGAGG - Exonic
1144955769 17:19018119-19018141 CCCTTCTAGGCCTGAGGGAGAGG - Intronic
1145874563 17:28307155-28307177 CCTTTGGGTGGCAGCGGGAGTGG + Intergenic
1145973165 17:28968746-28968768 CCCCTGCAGGACTGCGGAAGTGG + Intronic
1148475978 17:47928986-47929008 CCCTTGGAGAGCTCGGAGAGGGG + Intergenic
1148576837 17:48718484-48718506 CCTCTACAGGGCTGCGGGAGGGG + Intergenic
1148602626 17:48905964-48905986 TACTTGGAGGGCTGAGGCAGAGG + Intergenic
1149865289 17:60148237-60148259 CCCTCTGAGGAATGCGGGAGGGG - Intergenic
1150022308 17:61629930-61629952 CTCTTGGTGGGCTGCTGGATGGG + Intergenic
1151729222 17:75901123-75901145 GCCCTGGGGGGCTGGGGGAGGGG - Intronic
1152230835 17:79113258-79113280 ACCTTGGAAGGCAGCTGGAGAGG - Intronic
1153120680 18:1722830-1722852 GCCTTGGAGGGTTGGGGGTGGGG - Intergenic
1154390549 18:13932853-13932875 CCCTTTGAGGGCTGAGGATGTGG + Intergenic
1160271816 18:77393729-77393751 CCCTTTGAGGGCTCCAGGGGAGG + Intergenic
1160669329 19:349644-349666 ACTTTGGAAGGCTGAGGGAGGGG - Intergenic
1160675444 19:388832-388854 CCCGTGCAGGGCTGAGGGTGTGG - Intergenic
1161261761 19:3341677-3341699 TCTTGGGAGGGCTGCAGGAGGGG + Intergenic
1161377225 19:3946200-3946222 CCCTTAGATGGCTCTGGGAGGGG - Intergenic
1161478559 19:4499386-4499408 CCCGGGAGGGGCTGCGGGAGGGG + Intronic
1161588265 19:5117257-5117279 CCCCTGGAAGGCTGCAGCAGGGG + Intronic
1161664532 19:5567594-5567616 CCCCTGGAGAGCGGCGGGGGAGG - Intergenic
1162472630 19:10881602-10881624 CCCCTGGAGGGCTGGGGTGGGGG + Intronic
1162894657 19:13757987-13758009 GCCATGGAGGGTTGCGGGGGTGG - Intronic
1163117035 19:15195303-15195325 TCCTTGGTGGGCTTGGGGAGGGG - Intronic
1163118344 19:15201012-15201034 GCCTTCGAGGGCTGGGGGCGGGG - Intergenic
1163544515 19:17933130-17933152 CCCTGGGAAGGCTGGAGGAGGGG + Intronic
1163686734 19:18716038-18716060 CCCTTGCTGGGCTGCAGGTGGGG + Intronic
1163725871 19:18922764-18922786 CCTTTGAAGGGCGGTGGGAGGGG - Intronic
1163831601 19:19549743-19549765 CCCTGGGAGGGCTGAGGCATCGG - Intergenic
1166328573 19:42065874-42065896 CCCTTGGAGGCCTGCTGGATGGG + Intronic
1166738242 19:45098619-45098641 GCTTTGGAAGGCAGCGGGAGGGG + Intronic
1166844254 19:45717259-45717281 GCCTGGGGGGGCTGCGGGTGAGG - Intronic
1166861708 19:45815288-45815310 CCCGTGGAGGGCGCGGGGAGCGG + Exonic
1167041048 19:47022571-47022593 ACCTTGCAGGGCTGCTGGAGGGG + Intronic
1167449016 19:49556276-49556298 GCCTTGGAGTGCTGGGGGAAGGG + Intronic
1167646799 19:50710430-50710452 CCCTTGAAGGGCAGCTGGTGGGG - Intronic
1167697978 19:51026129-51026151 GCCTTTGAGGTCTGCTGGAGGGG + Intronic
1168380993 19:55923317-55923339 TTCTTGGAAGGCTGGGGGAGAGG + Intronic
1168722128 19:58559876-58559898 CCACTGGAGGGTTGGGGGAGAGG + Intergenic
925295354 2:2772836-2772858 GCCTTGGAGGGCTTCAGGAAGGG + Intergenic
925363106 2:3293321-3293343 CCCTTGGAAGACTTCAGGAGGGG + Intronic
927101148 2:19788770-19788792 ACCTTGGAGGGCTGGGGCACTGG - Intergenic
927872155 2:26630482-26630504 CTCTTGGAGGGCTGTGGCGGGGG + Intronic
928358979 2:30647887-30647909 TTCTGGGAGGGATGCGGGAGGGG + Intergenic
929925273 2:46202283-46202305 GCCTTGCAGGGTTGCTGGAGGGG + Intergenic
929954603 2:46446691-46446713 CCCTTGGTGGGCTCCTGGATGGG + Intronic
931282741 2:60808287-60808309 CCAGGGGAGGGCTGCGGGAGAGG + Intergenic
931437677 2:62262980-62263002 GCCCGGAAGGGCTGCGGGAGGGG - Intergenic
931504082 2:62904645-62904667 CCCCTGGAGGACTGGGGGATTGG + Intronic
933903072 2:86862704-86862726 CCCTTGGAGGGCTGCGGGAGAGG + Intergenic
934567042 2:95346837-95346859 CCCGTGGAGGGCGGCGGCGGCGG - Intronic
934622964 2:95826755-95826777 CCCTTGGCTGGCTGAGGGTGAGG + Intergenic
934810802 2:97275333-97275355 CCCTTGGCTGGCTGAGGGTGAGG - Intergenic
934826890 2:97432606-97432628 CCCTTGGCTGGCTGAGGGTGAGG + Intergenic
935777474 2:106486566-106486588 CCCTTGGAGGGCTGCGGGAGAGG - Intergenic
936263404 2:110980964-110980986 CCCCTGGTGTGCTGGGGGAGGGG - Intronic
937320582 2:120958438-120958460 CTCTTGGAGGCCTGAGGGACAGG - Intronic
937913426 2:127087385-127087407 CCCTGGGAGGGATGAGAGAGAGG - Intronic
939833761 2:147103367-147103389 CCTTTGGAGAGCTGAGAGAGAGG + Intergenic
941141852 2:161793427-161793449 CACTTGGGGGGCTGAGGAAGGGG - Intronic
941167412 2:162097616-162097638 CCCTTGGAGTTCTGCGTGATGGG + Intergenic
941548868 2:166889398-166889420 GCCTTGAAGGGCTGCTGCAGTGG + Intronic
945041345 2:205745958-205745980 CCCTGGGAGGGCTGTGGAGGGGG + Intronic
945102434 2:206274693-206274715 GCCTTGGATGCCTGCGTGAGTGG + Exonic
945178205 2:207064759-207064781 CACTTGGGGGGCTGCAGAAGAGG + Intergenic
945499056 2:210545943-210545965 TCCTGGGAGAGCTGCTGGAGAGG + Intronic
948695304 2:239730141-239730163 GGCTTGGAGGGCTGCTGGTGTGG + Intergenic
948716900 2:239871012-239871034 CCCTGGGGGGGCTGAAGGAGCGG + Intergenic
948942553 2:241203578-241203600 CCCCTGGAGGGCAGCGTGCGTGG + Intronic
949057576 2:241936834-241936856 CCCTCCGAGGGCTGCGGGAGAGG - Intergenic
1168742397 20:203202-203224 CCCATGGAAGGCAGCTGGAGAGG - Intergenic
1170405546 20:16032246-16032268 CCCTTGGAGGGTGGAGGGAGTGG + Intronic
1171768162 20:29301318-29301340 CGCTTGGAAGTCTGCGCGAGCGG - Intergenic
1173017987 20:39244140-39244162 CACATGGAGGGCTGTGGGTGTGG + Intergenic
1173167083 20:40692855-40692877 CTGTTGGAGGCGTGCGGGAGGGG + Intergenic
1175399814 20:58693629-58693651 CCCTTCCAGGACTGCAGGAGTGG + Intronic
1176142295 20:63550076-63550098 AACTTGGAGGGCAGCGGGACAGG - Intronic
1176148136 20:63574425-63574447 GCCCTGGAGGGGTGCGGGAAAGG - Intergenic
1178883618 21:36467504-36467526 TTCTTGGAGGGGTGCGGGGGTGG + Intronic
1179546245 21:42114075-42114097 CGCCTGGAAGGCTGCGGGTGCGG + Intronic
1179890704 21:44333858-44333880 CCTTTGAGGGCCTGCGGGAGCGG - Intronic
1180164756 21:46019166-46019188 CACTTGGGAGGCTGGGGGAGGGG - Intergenic
1181396117 22:22623724-22623746 TCCTTGGAAGGCTGAGGCAGGGG - Intergenic
1181693766 22:24582591-24582613 CCCTGGGATGGCTGTAGGAGAGG + Intronic
1182420444 22:30246124-30246146 CCCCGGGGTGGCTGCGGGAGGGG + Intronic
1182624264 22:31634475-31634497 CCCTTGGGGAGCTGCTGGTGGGG - Intronic
1183333230 22:37232462-37232484 CCCTGGGAGTGCTGGGGGAGGGG - Intronic
1184274123 22:43400496-43400518 CCATGGCATGGCTGCGGGAGGGG + Intergenic
1184479516 22:44738413-44738435 CGCGTGGAAGGCTGCGGGGGTGG - Intronic
1184680740 22:46071191-46071213 CCCGGGGCGGGCGGCGGGAGGGG + Intronic
1184877785 22:47286431-47286453 CATTTGGAGGACTGCAGGAGGGG + Intergenic
1184886125 22:47345367-47345389 ACCTTGGAGGCATGCAGGAGAGG + Intergenic
1185158786 22:49210055-49210077 CCCCTGGAGGGGTGGGGGAGGGG + Intergenic
1185189528 22:49425634-49425656 CCCTTGGAGGGCTGTGGGTGGGG + Intronic
1185270444 22:49927117-49927139 CCCTTGGATGGCTGCGTCCGGGG + Intronic
1185315619 22:50178024-50178046 TCCTTGAAGGGCTGCGGAAGCGG - Exonic
950337286 3:12206468-12206490 CTCTTGGAGGCCTAGGGGAGTGG - Intergenic
950425145 3:12921137-12921159 CCCTGGGGTGGCAGCGGGAGTGG - Intronic
950465088 3:13148896-13148918 CCCTGGAAAGGATGCGGGAGAGG - Intergenic
950534670 3:13571905-13571927 CCCTGGTAGGGCTGCGGTAGTGG + Intronic
952775235 3:37039686-37039708 CCCTTGGAGGGACAGGGGAGTGG + Intronic
952888182 3:38024543-38024565 CCCTTGGAGGGGAGCAGGGGCGG + Exonic
952902186 3:38117711-38117733 GGCTGGGAGGGCTGGGGGAGGGG - Intronic
953980631 3:47411213-47411235 ACCTTGGTGGGCTGCAGCAGGGG - Exonic
954693168 3:52406626-52406648 TCCTGGGTGGGCTGGGGGAGGGG - Intronic
955164396 3:56496535-56496557 CCCTGGGGGGGTGGCGGGAGAGG + Intergenic
958693850 3:97502722-97502744 CACTTGGGAGGCTGAGGGAGGGG + Intronic
958980131 3:100709998-100710020 CGCCTGGGGGGCTCCGGGAGGGG + Intronic
959943776 3:112106450-112106472 CTCTTGGCGGGCTGCTGGATGGG - Intronic
961866048 3:129954301-129954323 CCCTGGGAGGGCTGGGGTGGTGG + Intergenic
966931889 3:184680823-184680845 CCCTTTATGGGCTGCAGGAGTGG + Intronic
968067261 3:195765439-195765461 CCCTTGGAGGCCTGAGGTCGGGG + Exonic
968230465 3:197002533-197002555 CCCCTGAAGGGCTGCGCGTGGGG - Exonic
968234688 3:197024553-197024575 GCCTGGGCGGGCTGTGGGAGAGG + Intronic
968655063 4:1774892-1774914 CCCTTGGACTGCAGTGGGAGGGG - Intergenic
968755501 4:2413885-2413907 GGCTTGGAAGGCTGTGGGAGGGG - Intronic
969054109 4:4390907-4390929 CCCTTTGGGGGCTGTGGCAGGGG + Intronic
969226153 4:5799702-5799724 CCCTTGGAGGGCTCCTGGAAGGG - Intronic
969763208 4:9206346-9206368 CCCGTTGAGGGCTGGGGGTGAGG + Intergenic
970152749 4:13107037-13107059 GCCTAGCAGGGCTGTGGGAGTGG - Intergenic
971489145 4:27192584-27192606 CTCTTGGAGGGCTGCATGGGAGG + Intergenic
972795085 4:42407709-42407731 CCCTGGGAAGACTGTGGGAGAGG + Intergenic
976356723 4:84127204-84127226 CCCCAGGAGGGCTGGGGGAGGGG + Intergenic
976524924 4:86075980-86076002 CCCCAGGAGGGCTGGGGGAGGGG - Intronic
981045489 4:140261330-140261352 CTCTTGGAGAGCTGTTGGAGTGG - Intronic
981782756 4:148445166-148445188 ACTTTGGAGGGCTGCGGGCAGGG - Intergenic
983007364 4:162500687-162500709 CCCCTGGAGGGGTGGGAGAGAGG - Intergenic
983208317 4:164933390-164933412 CCCTCTGTGGGCTCCGGGAGAGG + Intergenic
983583530 4:169332881-169332903 CCCTTTAAGGGCTGTGGCAGGGG - Intergenic
983938830 4:173521705-173521727 TCCCTGGAGGGCTGGGGGAAGGG + Intergenic
984250085 4:177321218-177321240 ACCTTGGTGGGCAGTGGGAGTGG - Intronic
984973358 4:185209715-185209737 CCCTCGGTGGGCCGCGGGCGAGG + Intronic
984979847 4:185269817-185269839 TACTTGGAAGGCTGAGGGAGAGG - Intronic
985644691 5:1079372-1079394 TCCTTGGAGGGGTGCAGGCGAGG - Intronic
985730935 5:1548423-1548445 TCCCTGGAGTCCTGCGGGAGTGG + Intergenic
985877654 5:2612569-2612591 CCCAGGGAGGGCAGCGTGAGAGG - Intergenic
987753393 5:22069332-22069354 CCCTTGCAGGGCTGGGGCAAGGG + Intronic
987950649 5:24670526-24670548 CTCTTGGAGGTCTGGGGGAGAGG + Intergenic
989733599 5:44676364-44676386 CACTTGGGGGGCTGAGGCAGGGG + Intergenic
991404153 5:66285443-66285465 TCCTTGGAGGGCAGCCTGAGTGG + Intergenic
991457355 5:66818703-66818725 CCCTTGGATTGCTGCTGCAGTGG + Intronic
991922631 5:71671907-71671929 GCATTGGAGGGCGGGGGGAGGGG - Intergenic
992080415 5:73230934-73230956 CCCTCGCAGGGCTTCGGAAGGGG - Intergenic
992389311 5:76315610-76315632 CCCTTGGAGGGGAGTGGGAAGGG + Intronic
997583460 5:135031201-135031223 GCTTTGGAGGGCTGCAGCAGAGG + Intronic
998561954 5:143180233-143180255 CCCTTGGGAGGCTGAGGCAGGGG - Intronic
998646615 5:144069163-144069185 CTCTTGGTGGGCTCCTGGAGGGG + Intergenic
1002926577 6:1609068-1609090 CCCTTGGCGGCCTGAGGGTGCGG - Intergenic
1004336793 6:14771380-14771402 TCCTTGGAGGGCCGCTGGACTGG - Intergenic
1006631309 6:35431989-35432011 CCCTTGGGAGGCTGAGGCAGGGG + Intergenic
1006906231 6:37535658-37535680 CCCTGGTAGAGCTGGGGGAGGGG + Intergenic
1007360699 6:41353275-41353297 GCCCTGGAGGGCTGGGGAAGGGG - Intergenic
1007394646 6:41570533-41570555 CCCTAGGAGGGCAGAGGGCGGGG + Intronic
1007621142 6:43215345-43215367 CCCTTGCAGTGAGGCGGGAGAGG + Intronic
1007718334 6:43870179-43870201 GCCTGGGAGGGCTGGGGGAGGGG - Intergenic
1008786485 6:55174819-55174841 CCCTAGGAGGGCTGCCCGGGAGG - Intronic
1011314368 6:86015254-86015276 TACTTGGGGGGCTGAGGGAGGGG + Intergenic
1012861395 6:104564115-104564137 CCCTTTGAGGGCTGCTGTACAGG + Intergenic
1013416967 6:109934010-109934032 CTCATGGAGTGCTGCCGGAGGGG + Intergenic
1014629684 6:123773309-123773331 CACATGGAGGGCTCTGGGAGTGG - Intergenic
1016856779 6:148678748-148678770 CCCTTGGAAAGCTGAGGCAGTGG - Intergenic
1018091391 6:160348865-160348887 CCTTTGGAAGCCGGCGGGAGAGG + Intronic
1021194988 7:17665134-17665156 CCATTGGAGGGCGGCAGCAGGGG - Intergenic
1022532783 7:31077166-31077188 CCCTTGCAGGGGGCCGGGAGTGG - Intronic
1023722899 7:43113493-43113515 CCCATGGACGGGTGCAGGAGGGG + Intronic
1024551046 7:50562491-50562513 GCATTGGAGGTCTGTGGGAGGGG + Intronic
1025095364 7:56092010-56092032 CTCATGGAGGGCTGGGGGAGAGG - Intronic
1026787933 7:73313450-73313472 CCCTTGGAGAGCTCCAGGAGTGG + Exonic
1026923707 7:74174464-74174486 CCCGTCGGGGGCTGCGGGACCGG + Intronic
1029506842 7:100968039-100968061 CCCCTGGAGCCCTGCGGGTGGGG + Exonic
1029640134 7:101815597-101815619 CCTGGGGAGGGCTGCGGGGGTGG - Intergenic
1032401310 7:131626246-131626268 CCTTTGGGGGGATGAGGGAGAGG - Intergenic
1033606326 7:142930675-142930697 CCCTTGAAGCTCTGCTGGAGGGG + Intronic
1034414112 7:150955906-150955928 GCCTGGGCGGGCTGCGGGGGAGG - Intronic
1034707991 7:153163656-153163678 GACTTGGAGGGCTGCTGAAGAGG + Intergenic
1035023771 7:155813829-155813851 CCCTTGGAGTGGAGGGGGAGAGG + Intergenic
1035220336 7:157402618-157402640 CCAGGGGAGGGCTGTGGGAGTGG + Intronic
1035861874 8:3037612-3037634 CCGTAGTAGGGCTGCTGGAGCGG + Intronic
1036562238 8:9906885-9906907 GCGCTGGAGGGCTCCGGGAGGGG - Intergenic
1036607604 8:10321472-10321494 CCCTGGGAGGGAGGTGGGAGGGG - Intronic
1036706857 8:11052839-11052861 CCCTGCTAGGGGTGCGGGAGTGG - Intronic
1039000108 8:32970567-32970589 CCCAGGGAGGGTTGCGGGGGAGG + Intergenic
1040639224 8:49313104-49313126 CCCCTGGAGAGCAGCAGGAGAGG + Intergenic
1041008307 8:53516944-53516966 CCGTAGAAGGCCTGCGGGAGAGG + Intergenic
1041109397 8:54470485-54470507 CCCTTGGCGGGCGGCGCGCGCGG + Intergenic
1041521351 8:58759774-58759796 CACTTGGGGGGCTGTAGGAGTGG + Intergenic
1044591180 8:93916397-93916419 CCCAGGGTAGGCTGCGGGAGCGG - Intronic
1044758793 8:95494743-95494765 GCCTGGGATGGCTGCGGGAGGGG + Intergenic
1046181638 8:110656387-110656409 CACTTGGAGGGCTGAAGGTGGGG - Intergenic
1046630216 8:116616414-116616436 TCCTGGGAGGGCTGGAGGAGTGG - Intergenic
1047830193 8:128621187-128621209 GGCTTGGAGGCCTGTGGGAGTGG + Intergenic
1048992986 8:139772256-139772278 CCCGTGCAGGGCAGAGGGAGAGG + Intronic
1049148910 8:141021811-141021833 CCATGGGAGGGCTGCAGCAGTGG - Intergenic
1049304398 8:141893166-141893188 GCCTTGGTGGGGGGCGGGAGAGG - Intergenic
1049465198 8:142748101-142748123 CCCCTGGCGGGCTGATGGAGTGG - Intergenic
1049674186 8:143882565-143882587 GCCTGGTGGGGCTGCGGGAGAGG - Intergenic
1049802378 8:144523956-144523978 ACACTGGAGGGCTGCGGGAGTGG - Exonic
1051536783 9:18168272-18168294 CCCTTGTGGGGTTGGGGGAGGGG - Intergenic
1053231245 9:36411811-36411833 ACCTTGGAGGGCTGAGGTGGTGG - Intronic
1054891081 9:70252584-70252606 CTCTGGGAGGACTTCGGGAGTGG - Intergenic
1056830318 9:89911875-89911897 TCCATGGAGGGCCCCGGGAGGGG - Intergenic
1057265186 9:93612791-93612813 CTCTTGCAGGGCCCCGGGAGGGG + Intronic
1057314302 9:93958806-93958828 CCCTTTGGAGGCTGCGGGACAGG + Intergenic
1057519877 9:95752146-95752168 CACTGAGAGGGCAGCGGGAGGGG - Intergenic
1057540797 9:95967600-95967622 ACCATGGATGGCTGGGGGAGAGG + Exonic
1059336044 9:113569063-113569085 CCCATGGAGGGCAGGGAGAGGGG - Intronic
1060911220 9:127352684-127352706 CCCTCAGAGGCCTGCAGGAGTGG + Intronic
1061034733 9:128107202-128107224 CCCTGGGAGGTCGGGGGGAGCGG + Intronic
1061069500 9:128300419-128300441 GCCTGGGAGGGCTGCTGCAGTGG + Intergenic
1061856123 9:133442876-133442898 CCCTTGCAGGGCTGTGGGCAGGG - Intronic
1061993654 9:134173446-134173468 CCCCGGGAGGGCTGCTGGTGAGG + Intergenic
1062091510 9:134680937-134680959 GCCTCGGGGGGCAGCGGGAGAGG + Intronic
1062101832 9:134732462-134732484 CCCTTTGAGGGGTGGAGGAGAGG + Intronic
1062344616 9:136109130-136109152 CCCTGTGAGGGCTGTGGGCGTGG - Intergenic
1062458782 9:136654206-136654228 CCCCGGGAGGGCTGTGGAAGAGG + Intergenic
1062586447 9:137251933-137251955 TCTTTGGGGGGCTGTGGGAGGGG + Intronic
1188265393 X:28067152-28067174 CCCTTGGAGGGCTGGGGAGCTGG + Intergenic
1190055573 X:47179405-47179427 GCCTGGTAGGGCTGCGGCAGGGG - Exonic
1190058864 X:47198234-47198256 CCCAGGGATGGCGGCGGGAGCGG - Intronic
1191717930 X:64205747-64205769 GCCTTGGAGTACTGGGGGAGGGG - Intergenic
1192547217 X:72023997-72024019 CCCTAGGAGGCCTGAGGGAGAGG + Intergenic
1192860857 X:75069015-75069037 CCTTCGGAGGGCAGTGGGAGTGG - Exonic
1193397592 X:81003872-81003894 CCTTTGGGCGGCTGCAGGAGTGG - Intergenic
1200123101 X:153800539-153800561 CCCTTGGCTGGCTCAGGGAGAGG - Intergenic
1201060467 Y:10039656-10039678 TCCTTGGAAGGCTGAGGCAGGGG - Intergenic