ID: 935778339

View in Genome Browser
Species Human (GRCh38)
Location 2:106491102-106491124
Sequence CTGTGTTTCGGGATGCAAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935778332_935778339 25 Left 935778332 2:106491054-106491076 CCGCAAAAGGGACTATCCACGGT No data
Right 935778339 2:106491102-106491124 CTGTGTTTCGGGATGCAAGCCGG No data
935778335_935778339 9 Left 935778335 2:106491070-106491092 CCACGGTGAAGAGGTGGAACAGG No data
Right 935778339 2:106491102-106491124 CTGTGTTTCGGGATGCAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935778339 Original CRISPR CTGTGTTTCGGGATGCAAGC CGG Intergenic
No off target data available for this crispr