ID: 935782400

View in Genome Browser
Species Human (GRCh38)
Location 2:106519662-106519684
Sequence CTGTGTTACACGAAGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935782400_935782408 5 Left 935782400 2:106519662-106519684 CCGTCCACCTTCGTGTAACACAG No data
Right 935782408 2:106519690-106519712 TCCAATCTTTTGGCTTCCCTGGG 0: 728
1: 1007
2: 643
3: 334
4: 297
935782400_935782407 4 Left 935782400 2:106519662-106519684 CCGTCCACCTTCGTGTAACACAG No data
Right 935782407 2:106519689-106519711 GTCCAATCTTTTGGCTTCCCTGG 0: 680
1: 1004
2: 719
3: 347
4: 250
935782400_935782410 14 Left 935782400 2:106519662-106519684 CCGTCCACCTTCGTGTAACACAG No data
Right 935782410 2:106519699-106519721 TTGGCTTCCCTGGGCTACACTGG 0: 10
1: 327
2: 883
3: 861
4: 696
935782400_935782406 -5 Left 935782400 2:106519662-106519684 CCGTCCACCTTCGTGTAACACAG No data
Right 935782406 2:106519680-106519702 CACAGGGGTGTCCAATCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935782400 Original CRISPR CTGTGTTACACGAAGGTGGA CGG (reversed) Intergenic
No off target data available for this crispr