ID: 935782981

View in Genome Browser
Species Human (GRCh38)
Location 2:106524270-106524292
Sequence ATGAATATACAAAGGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935782981_935782991 29 Left 935782981 2:106524270-106524292 CCATTGTCCCTTTGTATATTCAT No data
Right 935782991 2:106524322-106524344 TTGAGGCTGAGCTTTATTTCCGG No data
935782981_935782987 12 Left 935782981 2:106524270-106524292 CCATTGTCCCTTTGTATATTCAT No data
Right 935782987 2:106524305-106524327 GATGCCCGAGGCCTGGGTTGAGG No data
935782981_935782986 6 Left 935782981 2:106524270-106524292 CCATTGTCCCTTTGTATATTCAT No data
Right 935782986 2:106524299-106524321 GTTTCTGATGCCCGAGGCCTGGG No data
935782981_935782984 0 Left 935782981 2:106524270-106524292 CCATTGTCCCTTTGTATATTCAT No data
Right 935782984 2:106524293-106524315 GCTCTTGTTTCTGATGCCCGAGG No data
935782981_935782985 5 Left 935782981 2:106524270-106524292 CCATTGTCCCTTTGTATATTCAT No data
Right 935782985 2:106524298-106524320 TGTTTCTGATGCCCGAGGCCTGG No data
935782981_935782992 30 Left 935782981 2:106524270-106524292 CCATTGTCCCTTTGTATATTCAT No data
Right 935782992 2:106524323-106524345 TGAGGCTGAGCTTTATTTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935782981 Original CRISPR ATGAATATACAAAGGGACAA TGG (reversed) Intergenic
No off target data available for this crispr