ID: 935785534

View in Genome Browser
Species Human (GRCh38)
Location 2:106545202-106545224
Sequence CAGTGAAAGGAGACGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935785534_935785539 27 Left 935785534 2:106545202-106545224 CCTGCCACCGTCTCCTTTCACTG No data
Right 935785539 2:106545252-106545274 ACAGTGAAGAAAGCAGACCCTGG No data
935785534_935785538 -8 Left 935785534 2:106545202-106545224 CCTGCCACCGTCTCCTTTCACTG No data
Right 935785538 2:106545217-106545239 TTTCACTGATATGACTCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935785534 Original CRISPR CAGTGAAAGGAGACGGTGGC AGG (reversed) Intergenic
No off target data available for this crispr