ID: 935788483 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:106570188-106570210 |
Sequence | CTCACCCCAATCAGCTCCCA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
935788483_935788486 | 8 | Left | 935788483 | 2:106570188-106570210 | CCTTGGGAGCTGATTGGGGTGAG | No data | ||
Right | 935788486 | 2:106570219-106570241 | ATGAGGAAGACACCCCATGATGG | No data | ||||
935788483_935788485 | -9 | Left | 935788483 | 2:106570188-106570210 | CCTTGGGAGCTGATTGGGGTGAG | No data | ||
Right | 935788485 | 2:106570202-106570224 | TGGGGTGAGATGAGGTCATGAGG | No data | ||||
935788483_935788487 | 9 | Left | 935788483 | 2:106570188-106570210 | CCTTGGGAGCTGATTGGGGTGAG | No data | ||
Right | 935788487 | 2:106570220-106570242 | TGAGGAAGACACCCCATGATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
935788483 | Original CRISPR | CTCACCCCAATCAGCTCCCA AGG (reversed) | Intergenic | ||