ID: 935788483

View in Genome Browser
Species Human (GRCh38)
Location 2:106570188-106570210
Sequence CTCACCCCAATCAGCTCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935788483_935788486 8 Left 935788483 2:106570188-106570210 CCTTGGGAGCTGATTGGGGTGAG No data
Right 935788486 2:106570219-106570241 ATGAGGAAGACACCCCATGATGG No data
935788483_935788485 -9 Left 935788483 2:106570188-106570210 CCTTGGGAGCTGATTGGGGTGAG No data
Right 935788485 2:106570202-106570224 TGGGGTGAGATGAGGTCATGAGG No data
935788483_935788487 9 Left 935788483 2:106570188-106570210 CCTTGGGAGCTGATTGGGGTGAG No data
Right 935788487 2:106570220-106570242 TGAGGAAGACACCCCATGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935788483 Original CRISPR CTCACCCCAATCAGCTCCCA AGG (reversed) Intergenic