ID: 935789283

View in Genome Browser
Species Human (GRCh38)
Location 2:106576140-106576162
Sequence TGTAATCAGCCTGATGGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935789280_935789283 -10 Left 935789280 2:106576127-106576149 CCAGAGGCTCTGATGTAATCAGC No data
Right 935789283 2:106576140-106576162 TGTAATCAGCCTGATGGTGTGGG No data
935789279_935789283 -4 Left 935789279 2:106576121-106576143 CCTGTTCCAGAGGCTCTGATGTA No data
Right 935789283 2:106576140-106576162 TGTAATCAGCCTGATGGTGTGGG No data
935789277_935789283 29 Left 935789277 2:106576088-106576110 CCAAACAGGCACTGCGGGGGCGT No data
Right 935789283 2:106576140-106576162 TGTAATCAGCCTGATGGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935789283 Original CRISPR TGTAATCAGCCTGATGGTGT GGG Intergenic
No off target data available for this crispr