ID: 935789995

View in Genome Browser
Species Human (GRCh38)
Location 2:106582200-106582222
Sequence CCCTGCCATGCGTGGGGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935789995_935790008 24 Left 935789995 2:106582200-106582222 CCTCCACCCCACGCATGGCAGGG No data
Right 935790008 2:106582247-106582269 TAGAGGTGCTGCGCTGCTCGCGG No data
935789995_935790001 -3 Left 935789995 2:106582200-106582222 CCTCCACCCCACGCATGGCAGGG No data
Right 935790001 2:106582220-106582242 GGGAGACCTCGCTCTCTCCGCGG No data
935789995_935790004 7 Left 935789995 2:106582200-106582222 CCTCCACCCCACGCATGGCAGGG No data
Right 935790004 2:106582230-106582252 GCTCTCTCCGCGGGCCCTAGAGG No data
935789995_935790009 28 Left 935789995 2:106582200-106582222 CCTCCACCCCACGCATGGCAGGG No data
Right 935790009 2:106582251-106582273 GGTGCTGCGCTGCTCGCGGCCGG No data
935789995_935790002 -2 Left 935789995 2:106582200-106582222 CCTCCACCCCACGCATGGCAGGG No data
Right 935790002 2:106582221-106582243 GGAGACCTCGCTCTCTCCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935789995 Original CRISPR CCCTGCCATGCGTGGGGTGG AGG (reversed) Intergenic
No off target data available for this crispr