ID: 935790011

View in Genome Browser
Species Human (GRCh38)
Location 2:106582258-106582280
Sequence CGCTGCTCGCGGCCGGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935790000_935790011 27 Left 935790000 2:106582208-106582230 CCACGCATGGCAGGGAGACCTCG No data
Right 935790011 2:106582258-106582280 CGCTGCTCGCGGCCGGCAGGAGG No data
935790006_935790011 -9 Left 935790006 2:106582244-106582266 CCCTAGAGGTGCTGCGCTGCTCG No data
Right 935790011 2:106582258-106582280 CGCTGCTCGCGGCCGGCAGGAGG No data
935789999_935790011 28 Left 935789999 2:106582207-106582229 CCCACGCATGGCAGGGAGACCTC No data
Right 935790011 2:106582258-106582280 CGCTGCTCGCGGCCGGCAGGAGG No data
935790007_935790011 -10 Left 935790007 2:106582245-106582267 CCTAGAGGTGCTGCGCTGCTCGC No data
Right 935790011 2:106582258-106582280 CGCTGCTCGCGGCCGGCAGGAGG No data
935789998_935790011 29 Left 935789998 2:106582206-106582228 CCCCACGCATGGCAGGGAGACCT No data
Right 935790011 2:106582258-106582280 CGCTGCTCGCGGCCGGCAGGAGG No data
935790005_935790011 -2 Left 935790005 2:106582237-106582259 CCGCGGGCCCTAGAGGTGCTGCG No data
Right 935790011 2:106582258-106582280 CGCTGCTCGCGGCCGGCAGGAGG No data
935790003_935790011 9 Left 935790003 2:106582226-106582248 CCTCGCTCTCTCCGCGGGCCCTA No data
Right 935790011 2:106582258-106582280 CGCTGCTCGCGGCCGGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935790011 Original CRISPR CGCTGCTCGCGGCCGGCAGG AGG Intergenic
No off target data available for this crispr