ID: 935794527

View in Genome Browser
Species Human (GRCh38)
Location 2:106628545-106628567
Sequence GGGTGCTGCAGCTGAGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935794527_935794530 -2 Left 935794527 2:106628545-106628567 CCATCTGCTCAGCTGCAGCACCC No data
Right 935794530 2:106628566-106628588 CCGATTGAAGCCTTCTTCCCTGG No data
935794527_935794534 20 Left 935794527 2:106628545-106628567 CCATCTGCTCAGCTGCAGCACCC No data
Right 935794534 2:106628588-106628610 GCAATACTCATCTCAGTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935794527 Original CRISPR GGGTGCTGCAGCTGAGCAGA TGG (reversed) Intergenic
No off target data available for this crispr