ID: 935799439

View in Genome Browser
Species Human (GRCh38)
Location 2:106678885-106678907
Sequence CAAATCGTGAAGGACCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935799439_935799443 -3 Left 935799439 2:106678885-106678907 CCCTCCAGGTCCTTCACGATTTG No data
Right 935799443 2:106678905-106678927 TTGAACTTTGCTTATTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935799439 Original CRISPR CAAATCGTGAAGGACCTGGA GGG (reversed) Intergenic
No off target data available for this crispr