ID: 935800693

View in Genome Browser
Species Human (GRCh38)
Location 2:106692305-106692327
Sequence CTGCAGAAGGGGCAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935800680_935800693 28 Left 935800680 2:106692254-106692276 CCACAACAATACGAGCAAATCCA No data
Right 935800693 2:106692305-106692327 CTGCAGAAGGGGCAGGTGGAGGG No data
935800684_935800693 -10 Left 935800684 2:106692292-106692314 CCAGAGAAACCCACTGCAGAAGG No data
Right 935800693 2:106692305-106692327 CTGCAGAAGGGGCAGGTGGAGGG No data
935800683_935800693 -9 Left 935800683 2:106692291-106692313 CCCAGAGAAACCCACTGCAGAAG No data
Right 935800693 2:106692305-106692327 CTGCAGAAGGGGCAGGTGGAGGG No data
935800682_935800693 2 Left 935800682 2:106692280-106692302 CCTTACAAATGCCCAGAGAAACC No data
Right 935800693 2:106692305-106692327 CTGCAGAAGGGGCAGGTGGAGGG No data
935800681_935800693 8 Left 935800681 2:106692274-106692296 CCACAACCTTACAAATGCCCAGA No data
Right 935800693 2:106692305-106692327 CTGCAGAAGGGGCAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935800693 Original CRISPR CTGCAGAAGGGGCAGGTGGA GGG Intergenic
No off target data available for this crispr