ID: 935802730

View in Genome Browser
Species Human (GRCh38)
Location 2:106714863-106714885
Sequence CATGCTTTATGGAGCCTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935802730_935802740 11 Left 935802730 2:106714863-106714885 CCCCCCAGGCTCCATAAAGCATG No data
Right 935802740 2:106714897-106714919 ACAAGTGTCCTTGTCTGCTAGGG No data
935802730_935802739 10 Left 935802730 2:106714863-106714885 CCCCCCAGGCTCCATAAAGCATG No data
Right 935802739 2:106714896-106714918 TACAAGTGTCCTTGTCTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935802730 Original CRISPR CATGCTTTATGGAGCCTGGG GGG (reversed) Intergenic
No off target data available for this crispr