ID: 935806541

View in Genome Browser
Species Human (GRCh38)
Location 2:106754262-106754284
Sequence ATATCCCATCTGTGTCTATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935806541_935806553 29 Left 935806541 2:106754262-106754284 CCTCATAGACACAGATGGGATAT No data
Right 935806553 2:106754314-106754336 GGTATTGGGGCAAGTGAGGCAGG No data
935806541_935806544 2 Left 935806541 2:106754262-106754284 CCTCATAGACACAGATGGGATAT No data
Right 935806544 2:106754287-106754309 ATGAATATACCTGGGTCCCATGG No data
935806541_935806552 25 Left 935806541 2:106754262-106754284 CCTCATAGACACAGATGGGATAT No data
Right 935806552 2:106754310-106754332 TACAGGTATTGGGGCAAGTGAGG No data
935806541_935806547 14 Left 935806541 2:106754262-106754284 CCTCATAGACACAGATGGGATAT No data
Right 935806547 2:106754299-106754321 GGGTCCCATGGTACAGGTATTGG No data
935806541_935806554 30 Left 935806541 2:106754262-106754284 CCTCATAGACACAGATGGGATAT No data
Right 935806554 2:106754315-106754337 GTATTGGGGCAAGTGAGGCAGGG No data
935806541_935806549 16 Left 935806541 2:106754262-106754284 CCTCATAGACACAGATGGGATAT No data
Right 935806549 2:106754301-106754323 GTCCCATGGTACAGGTATTGGGG No data
935806541_935806542 -7 Left 935806541 2:106754262-106754284 CCTCATAGACACAGATGGGATAT No data
Right 935806542 2:106754278-106754300 GGGATATATATGAATATACCTGG No data
935806541_935806543 -6 Left 935806541 2:106754262-106754284 CCTCATAGACACAGATGGGATAT No data
Right 935806543 2:106754279-106754301 GGATATATATGAATATACCTGGG No data
935806541_935806548 15 Left 935806541 2:106754262-106754284 CCTCATAGACACAGATGGGATAT No data
Right 935806548 2:106754300-106754322 GGTCCCATGGTACAGGTATTGGG No data
935806541_935806545 8 Left 935806541 2:106754262-106754284 CCTCATAGACACAGATGGGATAT No data
Right 935806545 2:106754293-106754315 ATACCTGGGTCCCATGGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935806541 Original CRISPR ATATCCCATCTGTGTCTATG AGG (reversed) Intergenic
No off target data available for this crispr