ID: 935806542

View in Genome Browser
Species Human (GRCh38)
Location 2:106754278-106754300
Sequence GGGATATATATGAATATACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935806541_935806542 -7 Left 935806541 2:106754262-106754284 CCTCATAGACACAGATGGGATAT No data
Right 935806542 2:106754278-106754300 GGGATATATATGAATATACCTGG No data
935806540_935806542 -4 Left 935806540 2:106754259-106754281 CCTCCTCATAGACACAGATGGGA No data
Right 935806542 2:106754278-106754300 GGGATATATATGAATATACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935806542 Original CRISPR GGGATATATATGAATATACC TGG Intergenic
No off target data available for this crispr