ID: 935806546

View in Genome Browser
Species Human (GRCh38)
Location 2:106754296-106754318
Sequence ATACCTGTACCATGGGACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935806546_935806555 2 Left 935806546 2:106754296-106754318 CCTGGGTCCCATGGTACAGGTAT No data
Right 935806555 2:106754321-106754343 GGGCAAGTGAGGCAGGGTAGAGG No data
935806546_935806553 -5 Left 935806546 2:106754296-106754318 CCTGGGTCCCATGGTACAGGTAT No data
Right 935806553 2:106754314-106754336 GGTATTGGGGCAAGTGAGGCAGG No data
935806546_935806552 -9 Left 935806546 2:106754296-106754318 CCTGGGTCCCATGGTACAGGTAT No data
Right 935806552 2:106754310-106754332 TACAGGTATTGGGGCAAGTGAGG No data
935806546_935806554 -4 Left 935806546 2:106754296-106754318 CCTGGGTCCCATGGTACAGGTAT No data
Right 935806554 2:106754315-106754337 GTATTGGGGCAAGTGAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935806546 Original CRISPR ATACCTGTACCATGGGACCC AGG (reversed) Intergenic
No off target data available for this crispr