ID: 935806548

View in Genome Browser
Species Human (GRCh38)
Location 2:106754300-106754322
Sequence GGTCCCATGGTACAGGTATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935806541_935806548 15 Left 935806541 2:106754262-106754284 CCTCATAGACACAGATGGGATAT No data
Right 935806548 2:106754300-106754322 GGTCCCATGGTACAGGTATTGGG No data
935806540_935806548 18 Left 935806540 2:106754259-106754281 CCTCCTCATAGACACAGATGGGA No data
Right 935806548 2:106754300-106754322 GGTCCCATGGTACAGGTATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935806548 Original CRISPR GGTCCCATGGTACAGGTATT GGG Intergenic
No off target data available for this crispr