ID: 935806552

View in Genome Browser
Species Human (GRCh38)
Location 2:106754310-106754332
Sequence TACAGGTATTGGGGCAAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935806540_935806552 28 Left 935806540 2:106754259-106754281 CCTCCTCATAGACACAGATGGGA No data
Right 935806552 2:106754310-106754332 TACAGGTATTGGGGCAAGTGAGG No data
935806541_935806552 25 Left 935806541 2:106754262-106754284 CCTCATAGACACAGATGGGATAT No data
Right 935806552 2:106754310-106754332 TACAGGTATTGGGGCAAGTGAGG No data
935806546_935806552 -9 Left 935806546 2:106754296-106754318 CCTGGGTCCCATGGTACAGGTAT No data
Right 935806552 2:106754310-106754332 TACAGGTATTGGGGCAAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935806552 Original CRISPR TACAGGTATTGGGGCAAGTG AGG Intergenic
No off target data available for this crispr