ID: 935808229

View in Genome Browser
Species Human (GRCh38)
Location 2:106770078-106770100
Sequence ACGGATTCACACACATACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935808229_935808233 0 Left 935808229 2:106770078-106770100 CCAAGGTATGTGTGTGAATCCGT No data
Right 935808233 2:106770101-106770123 TTCCTCCCCAGGAGGTTCCATGG No data
935808229_935808231 -8 Left 935808229 2:106770078-106770100 CCAAGGTATGTGTGTGAATCCGT No data
Right 935808231 2:106770093-106770115 GAATCCGTTTCCTCCCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935808229 Original CRISPR ACGGATTCACACACATACCT TGG (reversed) Intergenic
No off target data available for this crispr