ID: 935815205

View in Genome Browser
Species Human (GRCh38)
Location 2:106841081-106841103
Sequence TAATGTCAGCACAGGGACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1100
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 1063}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935815205 Original CRISPR TAATGTCAGCACAGGGACAC AGG Intronic
900918394 1:5654590-5654612 CAATGAGAACACAGGGACACAGG + Intergenic
901562393 1:10082852-10082874 CAATGAGAACACAGGGACACAGG - Intronic
901959469 1:12813181-12813203 CAATGAGAACACAGGGACACAGG - Intergenic
902647158 1:17807791-17807813 TAATGAGAACACATGGACACAGG + Intronic
902820779 1:18941958-18941980 GACTGTCAGCACAGGGTGACTGG - Intronic
903056904 1:20642330-20642352 TAAAGCTAGCACAGGGAGACAGG - Intronic
905983583 1:42254761-42254783 CAATGAGAGCACATGGACACAGG + Intronic
906936570 1:50219059-50219081 TAAAGCCAGCACAGGGAGACAGG + Intergenic
907532584 1:55115964-55115986 TAATGAGAACACATGGACACAGG + Intronic
907562441 1:55403254-55403276 CAATGTCTGCACAGAGCCACTGG + Intergenic
907572285 1:55494257-55494279 TAATGAGAACACATGGACACAGG - Intergenic
908264528 1:62365330-62365352 CAATGAGAGCACATGGACACAGG - Intergenic
908394573 1:63713675-63713697 TAAAGTCAGAACTGGGTCACTGG + Intergenic
908910363 1:69065879-69065901 CAATGAGAACACAGGGACACAGG - Intergenic
908978183 1:69923011-69923033 CAATGAGAGCACATGGACACAGG - Intronic
909249211 1:73329750-73329772 CAATGAGAGCACATGGACACAGG - Intergenic
909363848 1:74797042-74797064 CAATGTGAACACATGGACACAGG - Intergenic
910307882 1:85787410-85787432 CAATGTGAACACATGGACACAGG - Intronic
910438610 1:87229853-87229875 TAATGAAAACACATGGACACAGG - Intergenic
910703118 1:90098023-90098045 CAATGAGAGCACATGGACACAGG + Intergenic
911535837 1:99099042-99099064 CAATGAGAGCACATGGACACAGG - Intergenic
911688255 1:100801841-100801863 CAATGAGAGCACATGGACACTGG - Intergenic
911838386 1:102650223-102650245 CAATGACAACACATGGACACAGG - Intergenic
912123515 1:106504025-106504047 TAATGAAAGCACAAGGACCCAGG - Intergenic
912166800 1:107051156-107051178 CAATGAGAACACAGGGACACAGG + Intergenic
912760277 1:112360192-112360214 TACTCTGACCACAGGGACACTGG - Intergenic
913016530 1:114742334-114742356 TAATCCCAGCACAGGGAGGCCGG + Intronic
913399167 1:118409095-118409117 AAATGAGAGCACATGGACACAGG + Intergenic
913494052 1:119411084-119411106 TGATGTAAGCACAAGGACACAGG - Intergenic
913494056 1:119411133-119411155 TGATGTAAGCACAAGGACACAGG - Intergenic
913546600 1:119874933-119874955 TAATGAGAACACATGGACACAGG - Intergenic
913584531 1:120261059-120261081 TAATGAGAACACATGGACACAGG + Intergenic
913623653 1:120637300-120637322 TAATGAGAACACATGGACACAGG - Intergenic
913719757 1:121580205-121580227 TAATGAGAACACATGGACACAGG + Intergenic
914399880 1:147308592-147308614 TAATGAGAACACATGGACACAGG + Intergenic
914566528 1:148872915-148872937 TAATGAGAACACATGGACACAGG + Intronic
914606291 1:149257325-149257347 TAATGAGAACACATGGACACAGG - Intergenic
915649645 1:157300173-157300195 CAATGAGAGCACATGGACACAGG + Intergenic
915653479 1:157337361-157337383 CAATGAGAGCACATGGACACAGG - Intergenic
915690237 1:157681436-157681458 TAATGAGAACACATGGACACAGG - Intronic
915790466 1:158664475-158664497 CAATGACAACACATGGACACAGG + Intronic
915882339 1:159685199-159685221 TAATGAGATCACATGGACACAGG - Intergenic
916286786 1:163115090-163115112 TAATGAGAACACATGGACACAGG + Intronic
916413445 1:164570402-164570424 CAATGAGAGCACATGGACACAGG - Intronic
916621559 1:166503591-166503613 CAATGAGAGCACATGGACACAGG + Intergenic
916621629 1:166504254-166504276 CAATGAGAGCACATGGACACAGG + Intergenic
916810709 1:168303235-168303257 CAATGAGAGCACATGGACACAGG - Intronic
916940363 1:169670564-169670586 TAATGAGAACACATGGACACAGG + Intronic
917159984 1:172046352-172046374 TAATGAGAACACATGGACACAGG + Intronic
917230301 1:172829397-172829419 TAATGAGAACACATGGACACAGG - Intergenic
917242294 1:172961426-172961448 CAATGAGAACACAGGGACACGGG - Intergenic
917694757 1:177510872-177510894 CAATGAGAACACAGGGACACAGG + Intergenic
918361454 1:183763186-183763208 CAATGAGAACACAGGGACACAGG + Intronic
918684807 1:187401277-187401299 TAATGAGAACACATGGACACAGG + Intergenic
918700714 1:187603483-187603505 CAATGAGATCACAGGGACACAGG + Intergenic
918830831 1:189395711-189395733 TAATGAGAACACAAGGACACAGG + Intergenic
918944165 1:191039705-191039727 CAATGAGAGCACATGGACACAGG - Intergenic
918946454 1:191072039-191072061 TAATGAGAACACATGGACACAGG + Intergenic
919160815 1:193828145-193828167 CAATGAGAACACAGGGACACAGG + Intergenic
919211508 1:194492818-194492840 CAATGAGAGCACATGGACACAGG - Intergenic
919290224 1:195620799-195620821 CAATGTGAACACATGGACACAGG + Intergenic
919347928 1:196410364-196410386 TAATGAGAACACATGGACACAGG + Intronic
919601346 1:199626541-199626563 CAATGAGAACACAGGGACACAGG + Intergenic
920850723 1:209626463-209626485 TGATGTCACCACAGGAGCACAGG - Intronic
920951616 1:210576463-210576485 TAATGAGAACACATGGACACAGG + Intronic
921415979 1:214887261-214887283 CAATGTGAACACATGGACACAGG - Intergenic
921509964 1:216016140-216016162 CAATGAGAGCACATGGACACAGG + Intronic
921617014 1:217280874-217280896 CAATGTGAACACATGGACACAGG + Intergenic
921876779 1:220205660-220205682 TGTGGTCAGCACAGGAACACCGG - Intronic
921964234 1:221071027-221071049 TAACGCCAGAACAGGGAAACAGG + Intergenic
922919692 1:229292014-229292036 TAATGAGAACACATGGACACAGG + Intronic
923357842 1:233178131-233178153 TATTGTCAGCAGTGGGACATGGG + Intronic
923365847 1:233259667-233259689 TAATGAGAACACATGGACACAGG - Intronic
923837450 1:237628414-237628436 CAATGTGAACACATGGACACAGG - Intronic
923875867 1:238046355-238046377 CAATGAGAACACAGGGACACAGG - Intergenic
924128689 1:240882935-240882957 CAATGAGAGCACATGGACACAGG - Intronic
924229211 1:241949284-241949306 CAAAGACAACACAGGGACACAGG - Intergenic
924884670 1:248201639-248201661 TAATGAGAGCACATGGACACAGG - Intergenic
924889488 1:248258661-248258683 TAATGAGAACACATGGACACAGG + Intergenic
1063076817 10:2724992-2725014 TAATGAGAACACATGGACACAGG - Intergenic
1063327000 10:5113881-5113903 CAATGAGAACACAGGGACACAGG + Intronic
1063404321 10:5778082-5778104 CAATGACAACACATGGACACAGG + Intronic
1063704206 10:8415097-8415119 TAATGAGAACACATGGACACAGG - Intergenic
1063869949 10:10406179-10406201 CAATGAGAGCACATGGACACAGG + Intergenic
1064274864 10:13896466-13896488 TAATGAGAACACATGGACACAGG + Intronic
1064473802 10:15664710-15664732 CAATGAGAGCACATGGACACAGG - Intronic
1065619635 10:27567698-27567720 CAATGAGAGCACATGGACACAGG - Intergenic
1066032534 10:31443606-31443628 CAATGAGAGCACATGGACACAGG - Intronic
1066194486 10:33085595-33085617 TAATGTCACCACACTGAAACAGG + Intergenic
1066253350 10:33655104-33655126 TAATGTCTGCAAAGTGGCACTGG + Intergenic
1066627666 10:37425648-37425670 TAATGAGAACACATGGACACAGG - Intergenic
1066803439 10:39216474-39216496 TAATGAGATCACATGGACACAGG + Intergenic
1066982571 10:42431914-42431936 CAATGAGAGCACATGGACACAGG - Intergenic
1067249754 10:44576358-44576380 GGACGTCAGCACAGGGACCCAGG - Intergenic
1068076837 10:52266414-52266436 TAATGTGAGCACATGGACACAGG - Intronic
1068195225 10:53707313-53707335 TAATGAGAACACAGGGACACAGG - Intergenic
1068785843 10:60972482-60972504 CAATGAGAACACAGGGACACAGG + Intronic
1068788621 10:61003123-61003145 CAATGAGAACACAGGGACACAGG - Intergenic
1068900653 10:62266110-62266132 TAGCGTCAGGACAGTGACACAGG - Intronic
1069255767 10:66330263-66330285 CAATGAGAACACAGGGACACAGG - Intronic
1069278224 10:66619509-66619531 CAATGACAACACATGGACACAGG + Intronic
1069371662 10:67754253-67754275 TAATGAGAACACATGGACACAGG + Intergenic
1069380237 10:67836145-67836167 CAATGAGAGCACATGGACACAGG + Intronic
1070448453 10:76532220-76532242 TAATGAGAACACATGGACACAGG - Intronic
1070452447 10:76575220-76575242 CAATGTGAGCACATTGACACAGG - Intergenic
1071030738 10:81177796-81177818 AAAAGTCAGCACAGAGACAAAGG + Intergenic
1071160115 10:82735702-82735724 CAATGAAAGCACATGGACACAGG + Intronic
1071164143 10:82785151-82785173 CAATGAGAGCACATGGACACAGG + Intronic
1071202703 10:83238331-83238353 CAATGAGAGCACATGGACACAGG - Intergenic
1071247526 10:83781251-83781273 TAATGAGATCACATGGACACAGG - Intergenic
1071410825 10:85393138-85393160 CAATGAGAACACAGGGACACAGG - Intergenic
1071867190 10:89747683-89747705 CAATGAGAGCACATGGACACAGG + Intronic
1072550332 10:96472407-96472429 GAATGTCTGCACAGGGGCAGAGG + Intronic
1073659797 10:105462356-105462378 CAATGAGAACACAGGGACACAGG - Intergenic
1074090423 10:110248142-110248164 CAATGACAACACATGGACACAGG + Intronic
1074581079 10:114720067-114720089 AAATGAGAGCACAGGGACACAGG - Intergenic
1074633194 10:115282452-115282474 AAATGTGAACACATGGACACAGG - Intronic
1075018490 10:118928972-118928994 TAATGTCAGCAAAGGCCAACCGG + Intergenic
1075196096 10:120360420-120360442 CAATGACAACACATGGACACAGG + Intergenic
1075315807 10:121452422-121452444 TAATGAGAACACATGGACACAGG - Intergenic
1075821533 10:125317148-125317170 TAATGAGAACACATGGACACAGG + Intergenic
1075962884 10:126584638-126584660 TGCTGTTAGCACAGGGACAGGGG - Intronic
1076582495 10:131520925-131520947 TAATGAGAACACATGGACACAGG - Intergenic
1077522726 11:3045851-3045873 TACTGTCATCCCAGGGACATGGG + Intronic
1077672699 11:4170437-4170459 CAATGAGAGCACATGGACACAGG - Intergenic
1077812951 11:5657258-5657280 CAATGTGAACACATGGACACAGG + Intergenic
1077942912 11:6862813-6862835 TAATCTCAGCACTGGAACTCTGG - Intergenic
1078552480 11:12290129-12290151 GAATGGCAGCCCAGGGACAAGGG + Intronic
1078621143 11:12909471-12909493 CAATGAGAACACAGGGACACAGG + Intronic
1079021857 11:16915556-16915578 CAATGAGAGCACATGGACACAGG - Intronic
1079482728 11:20898367-20898389 CAATGACAACACATGGACACAGG + Intronic
1079585600 11:22123416-22123438 CAATGAGAGCACATGGACACAGG + Intergenic
1080141935 11:28931993-28932015 CAATGAGAACACAGGGACACAGG - Intergenic
1080177249 11:29379794-29379816 CAATGTGAACACATGGACACAGG + Intergenic
1080238856 11:30103477-30103499 CAATGAGAGCACATGGACACAGG + Intergenic
1080334960 11:31185206-31185228 CAATGAGAACACAGGGACACAGG + Intronic
1080788954 11:35502454-35502476 AAATGACAACACATGGACACAGG - Intronic
1080904378 11:36526277-36526299 TAATGAGAACACATGGACACAGG - Intronic
1081593461 11:44443235-44443257 CAATGAGAGCACATGGACACAGG + Intergenic
1081681597 11:45009492-45009514 CAATGAGAGCACATGGACACAGG - Intergenic
1081707446 11:45192043-45192065 TAATGAGAACACATGGACACAGG - Intronic
1082135281 11:48542180-48542202 CAATGAGAGCACATGGACACAGG - Intergenic
1082246316 11:49927237-49927259 CAATGAGAGCACATGGACACAGG - Intergenic
1082269766 11:50157344-50157366 CAATGAGAGCACATGGACACAGG + Intergenic
1082305106 11:50562638-50562660 TAATGAGAACACATGGACACAGG + Intergenic
1082581142 11:54870948-54870970 TAATGAGAACACATGGACACAGG - Intergenic
1082596687 11:55090317-55090339 CAATGTGAACACAAGGACACAGG + Intergenic
1082601820 11:55167723-55167745 CAATGAGAGCACATGGACACAGG - Intergenic
1082660072 11:55898707-55898729 CAATGAGAGCACATGGACACAGG + Intergenic
1082697256 11:56384251-56384273 TGATGACATGACAGGGACACTGG + Intergenic
1083381347 11:62271235-62271257 GAGTGACAACACAGGGACACTGG - Intronic
1085647005 11:78230906-78230928 TCAGGTCATCACAGTGACACAGG - Intronic
1085723764 11:78935902-78935924 AAATGCTAGCTCAGGGACACTGG - Intronic
1086016152 11:82169899-82169921 CAATGTGAACACATGGACACAGG - Intergenic
1086025291 11:82283276-82283298 CAATGTGAACACATGGACACAGG + Intergenic
1086044494 11:82516967-82516989 CAATGTGAACACATGGACACAGG - Intergenic
1086050382 11:82582066-82582088 TAATGAGAACACATGGACACAGG + Intergenic
1086301384 11:85430156-85430178 CAATGAGAGCACATGGACACAGG + Intronic
1086352064 11:85952204-85952226 CAATGAGAGCACATGGACACAGG - Intergenic
1086586438 11:88458044-88458066 CAATGACAACACATGGACACAGG - Intergenic
1086779405 11:90883369-90883391 TAATGAGAACACATGGACACAGG + Intergenic
1086883392 11:92175361-92175383 TAATGAGAACACATGGACACAGG + Intergenic
1086889852 11:92245288-92245310 TAATGAGAACACATGGACACAGG + Intergenic
1087018177 11:93574917-93574939 CAATGTAAACACATGGACACAGG + Intergenic
1087404323 11:97711470-97711492 CAATGAGAACACAGGGACACAGG + Intergenic
1087815073 11:102649233-102649255 TAATGAGAACACATGGACACAGG - Intergenic
1087823743 11:102741630-102741652 CAATGAGAGCACATGGACACAGG - Intergenic
1087859456 11:103136419-103136441 CAATGAGAGCACATGGACACAGG - Intronic
1088103531 11:106180473-106180495 TAATGAGAACACATGGACACAGG - Intergenic
1088150337 11:106737592-106737614 CAATGAGAACACAGGGACACAGG - Intronic
1088523418 11:110725008-110725030 CAATGAGAGCACATGGACACAGG - Intergenic
1089570916 11:119408841-119408863 TAATGGCAGCAGAGGGCCTCCGG - Intergenic
1089808996 11:121116018-121116040 TAATCACAGCACAGGGAAAGGGG - Intronic
1090117470 11:123988846-123988868 CAATGAGAGCACATGGACACAGG + Intergenic
1090271799 11:125391248-125391270 TCTCGTCACCACAGGGACACAGG - Intronic
1090351000 11:126108177-126108199 CAATGAGAGCACATGGACACAGG + Intergenic
1090694768 11:129228654-129228676 TGATGACAACACATGGACACAGG + Intronic
1091245388 11:134089502-134089524 CAATGAGAACACAGGGACACAGG - Intronic
1091715034 12:2770872-2770894 CAATGACAACACATGGACACAGG + Intergenic
1092702760 12:11250877-11250899 CAATGAGAACACAGGGACACAGG - Intergenic
1092703838 12:11262740-11262762 CAATGAGAACACAGGGACACAGG + Intergenic
1092707837 12:11303877-11303899 CAATGAGAACACAGGGACACAGG + Intergenic
1092923103 12:13249882-13249904 CAATGAGAACACAGGGACACAGG - Intergenic
1093011870 12:14115695-14115717 TAATGAGAACACATGGACACAGG + Intergenic
1093180822 12:15965495-15965517 TAATGAGAACACATGGACACAGG - Intronic
1093309267 12:17559303-17559325 TAATGAGAACACATGGACACAGG - Intergenic
1093316373 12:17656172-17656194 TAATGAGATCACATGGACACAGG - Intergenic
1093374567 12:18409344-18409366 TAATGAGAACACATGGACACAGG + Intronic
1093627489 12:21366346-21366368 CAATGAGAACACAGGGACACAGG + Intronic
1093740153 12:22676203-22676225 TAATGAGAGCACATGGACACAGG - Intronic
1093806559 12:23440200-23440222 TGATGGCAACACATGGACACAGG + Intergenic
1094195564 12:27745759-27745781 CAATGAGAACACAGGGACACAGG - Intronic
1094428217 12:30338126-30338148 TAATGAGAACACATGGACACAGG + Intergenic
1094705555 12:32911111-32911133 AAATGTCAACACAGGGAAAAAGG - Intergenic
1094710975 12:32962117-32962139 TAATGAGAACACATGGACACAGG + Intergenic
1094715944 12:33015462-33015484 TAATGAGAACACATGGACACAGG + Intergenic
1094730584 12:33170018-33170040 TAATGAGAACACATGGACACAGG + Intergenic
1096942375 12:55361175-55361197 TAATGAGAACACATGGACACAGG + Intergenic
1097329358 12:58316667-58316689 TAAAGTCTGCACATTGACACAGG + Intergenic
1097468583 12:59959026-59959048 TAATGAGAACACATGGACACAGG + Intergenic
1097557218 12:61154124-61154146 TAATGAGAACACATGGACACAGG - Intergenic
1097574729 12:61377328-61377350 TAATGAGAACACATGGACACAGG - Intergenic
1097620209 12:61929952-61929974 CAATGACAACACATGGACACAGG + Intronic
1097673179 12:62566684-62566706 TAATGAGAACACATGGACACAGG + Intronic
1098439331 12:70501371-70501393 TAATGAGAACACATGGACACAGG - Intergenic
1098878763 12:75894746-75894768 CAATGAGAACACAGGGACACAGG + Intergenic
1098927280 12:76364447-76364469 CAATGACAACACATGGACACAGG + Intronic
1098992931 12:77085086-77085108 CAATGAGAGCACATGGACACAGG - Intergenic
1099358385 12:81666558-81666580 TAATGAGAACACATGGACACAGG + Intronic
1099489198 12:83267526-83267548 TAATGAGAACACATGGACACAGG - Intergenic
1099741484 12:86641316-86641338 CAATGACAACACATGGACACAGG + Intronic
1099755903 12:86847612-86847634 TAATGAGAACACATGGACACAGG + Intergenic
1099809453 12:87562153-87562175 TAATGAGAACACATGGACACAGG + Intergenic
1099900768 12:88709049-88709071 CAATGAGATCACAGGGACACAGG - Intergenic
1100051302 12:90451497-90451519 TAATGAGAACACATGGACACAGG - Intergenic
1100067484 12:90666926-90666948 CAATGAGAGCACATGGACACAGG + Intergenic
1100907907 12:99322301-99322323 TAATGAGAACACATGGACACAGG + Intronic
1101239877 12:102827372-102827394 CAATGAGAGCACATGGACACAGG - Intergenic
1101277677 12:103220207-103220229 TAATGAGAACACATGGACACAGG + Intergenic
1101702782 12:107190988-107191010 CAATGACAACACATGGACACAGG + Intergenic
1102730064 12:115101079-115101101 CAATGAGAGCACATGGACACAGG + Intergenic
1102780700 12:115562167-115562189 CAATGTCAGCACAGGCAGGCAGG + Intergenic
1103197477 12:119057389-119057411 TGATGACAACACATGGACACGGG - Intronic
1104114027 12:125731734-125731756 CAATGAGAGCACATGGACACAGG + Intergenic
1104228362 12:126859288-126859310 CAGTGTCAGAACTGGGACACAGG - Intergenic
1104679328 12:130738435-130738457 CAATGTGAACACATGGACACGGG - Intergenic
1106651328 13:31693261-31693283 CAATGAGAACACAGGGACACAGG - Intergenic
1107284803 13:38779174-38779196 CAATGAGAACACAGGGACACAGG + Intronic
1107375417 13:39799073-39799095 CAATGAGAGCACATGGACACAGG - Intergenic
1108099821 13:46943015-46943037 CAATGAGAACACAGGGACACAGG + Intergenic
1108264217 13:48688451-48688473 TAATGAGAACACACGGACACAGG - Intronic
1108565241 13:51690389-51690411 CAATGAGAGCACATGGACACAGG - Intronic
1108749841 13:53437405-53437427 CAATGAGAGCACATGGACACAGG - Intergenic
1108976297 13:56447295-56447317 TAATGAGAACACATGGACACAGG + Intergenic
1109013746 13:56981813-56981835 CAATGAGAACACAGGGACACAGG - Intergenic
1109138671 13:58684734-58684756 TAATGACTGCAGAGGGACTCTGG + Intergenic
1109237605 13:59843897-59843919 TAATGGGAACACATGGACACAGG + Intronic
1109401425 13:61834389-61834411 TAATGAGAACACATGGACACAGG + Intergenic
1109592383 13:64502994-64503016 CAATGAGAGCACATGGACACAGG - Intergenic
1109791577 13:67255369-67255391 TAATGCTAGCACATGGAGACGGG + Intergenic
1110091163 13:71449867-71449889 TAATGAGAACACATGGACACAGG + Intronic
1110202539 13:72869413-72869435 CAATGAGAGCACATGGACACAGG + Intronic
1110517485 13:76432090-76432112 TAATGAGAACACATGGACACAGG + Intergenic
1110530852 13:76596003-76596025 CAATGAGAACACAGGGACACAGG + Intergenic
1110752866 13:79136316-79136338 CAATGAGAACACAGGGACACAGG + Intergenic
1111043534 13:82783849-82783871 TAATGAGAACACATGGACACAGG - Intergenic
1111066570 13:83101683-83101705 TAATGAGAGCACATGGACACAGG + Intergenic
1111731602 13:92084069-92084091 TAATGAGAACACATGGACACAGG + Intronic
1112634377 13:101199086-101199108 TAATGAGAACACATGGACACAGG + Intronic
1112679171 13:101742083-101742105 TAATGAGAACACATGGACACAGG - Intronic
1112783706 13:102929178-102929200 TGAGGTCAGCACAGGTAGACAGG + Intergenic
1112951090 13:104997828-104997850 CAATGAGAGCACTGGGACACAGG + Intergenic
1113106573 13:106778437-106778459 TAATGAGAACACATGGACACAGG - Intergenic
1113281820 13:108796714-108796736 TAATGAGAACACATGGACACAGG + Intronic
1113409843 13:110075303-110075325 CAATGAGAACACAGGGACACAGG - Intergenic
1113452751 13:110423387-110423409 CAATGTGAACACATGGACACAGG + Intronic
1113491525 13:110695972-110695994 CAATGAGAGCACATGGACACAGG - Intronic
1113684536 13:112273234-112273256 TATTGTCAATACAGGGAAACAGG + Intergenic
1113695932 13:112345381-112345403 TAATTTCACCACAGAGACCCCGG - Intergenic
1114042273 14:18689966-18689988 CAATGAGAACACAGGGACACGGG + Intergenic
1114678564 14:24462584-24462606 CAATGACAACACATGGACACAGG - Intergenic
1114698348 14:24649067-24649089 CAATGGCAACACATGGACACAGG + Intergenic
1114761147 14:25315935-25315957 TAATGAGAACACATGGACACAGG - Intergenic
1114804146 14:25814830-25814852 AAATGAGAGCACATGGACACAGG + Intergenic
1114939952 14:27596507-27596529 CAATGAGAACACAGGGACACAGG - Intergenic
1115414163 14:33111862-33111884 TAATGAGAACACATGGACACAGG - Intronic
1115578734 14:34737116-34737138 CAATGACAACACATGGACACAGG - Intergenic
1116100217 14:40424244-40424266 CAATGAGAGCACATGGACACAGG + Intergenic
1116165048 14:41324568-41324590 TAATGAGAACACATGGACACAGG - Intergenic
1116247552 14:42435411-42435433 CAATGTGAACACATGGACACAGG + Intergenic
1116266342 14:42695310-42695332 TAATGAGAACACATGGACACAGG - Intergenic
1116364956 14:44048450-44048472 CAATGACAACACATGGACACAGG + Intergenic
1116417724 14:44698884-44698906 CAATGAGAACACAGGGACACAGG + Intergenic
1116486856 14:45459848-45459870 CAATGAGAACACAGGGACACAGG - Intergenic
1116550660 14:46233117-46233139 CAATGACAACACATGGACACAGG + Intergenic
1116661444 14:47716035-47716057 CAATGAGAGCACATGGACACAGG - Intergenic
1116731673 14:48630532-48630554 CAATGAGAGCACATGGACACAGG - Intergenic
1116795974 14:49390517-49390539 TAATGAGAACACATGGACACAGG + Intergenic
1117924623 14:60765319-60765341 TAATGAGAACACATGGACACAGG + Intronic
1118521684 14:66593095-66593117 CAATGAGAGCACATGGACACAGG + Intronic
1119006566 14:70936324-70936346 CAATGGGAGCACATGGACACAGG - Intronic
1120770641 14:88375829-88375851 TAATGAGAACACATGGACACAGG + Intergenic
1121437618 14:93929410-93929432 TATGGTCTGCACAGGGACAGCGG - Exonic
1121799772 14:96764828-96764850 CAATGACAACACATGGACACAGG - Intergenic
1122450895 14:101806303-101806325 TAATGAGAACACATGGACACAGG - Intronic
1123214588 14:106795059-106795081 CAATGAGAGCACATGGACACAGG - Intergenic
1123227386 15:17054779-17054801 TAATGAGAACACATGGACACAGG - Intergenic
1123452289 15:20376351-20376373 TAATGCGAACACATGGACACAGG + Intergenic
1123819947 15:24018794-24018816 TAATGAGAACACATGGACACAGG + Intergenic
1124759741 15:32439141-32439163 CAATGAGAGCACATGGACACAGG - Intergenic
1125224951 15:37385502-37385524 CAATGAGAGCACATGGACACAGG - Intergenic
1125252227 15:37718003-37718025 TAATGAGAACACATGGACACAGG - Intergenic
1125269705 15:37924663-37924685 TAATGAGAACACATGGACACAGG + Intronic
1125353118 15:38788547-38788569 CAATGAGAGCACATGGACACAGG + Intergenic
1125450528 15:39802140-39802162 TACTGCAAACACAGGGACACTGG + Exonic
1126237236 15:46400439-46400461 TAATGAGAACACATGGACACAGG + Intergenic
1126721634 15:51587362-51587384 CAATGACAACACATGGACACAGG - Intronic
1126818005 15:52472586-52472608 CAATGAGAACACAGGGACACAGG - Intronic
1127042882 15:54996753-54996775 CAATGACAACACATGGACACAGG + Intergenic
1127181307 15:56421660-56421682 TAATGAGAACACATGGACACAGG - Intronic
1127751929 15:62054518-62054540 CAATGACAACACATGGACACAGG + Intronic
1128676984 15:69617225-69617247 TAATGAGAACACATGGACACAGG - Intergenic
1128712162 15:69880017-69880039 CAATGAGAGCACATGGACACAGG - Intergenic
1129005727 15:72371837-72371859 TAATGGCTGCAGAAGGACACAGG + Intronic
1129846687 15:78771100-78771122 TAGTGTCTGGACAGGGACACTGG - Intronic
1130111039 15:80965750-80965772 TAATGAGAACACATGGACACAGG + Intronic
1130255212 15:82322791-82322813 TCATCTCTGGACAGGGACACCGG + Intergenic
1130484114 15:84388241-84388263 CAATGAGAACACAGGGACACAGG - Intergenic
1130599762 15:85267215-85267237 TCATCTCTGGACAGGGACACCGG - Intergenic
1130716222 15:86337653-86337675 CAATGAGAGCACATGGACACAGG + Intronic
1130855873 15:87839566-87839588 CAATGAGAGCACATGGACACAGG + Intergenic
1130971957 15:88740640-88740662 TAATCTGAGCACAAGGACATGGG - Intergenic
1131192556 15:90328681-90328703 TAATGAGAACACATGGACACAGG - Intergenic
1131453732 15:92566875-92566897 CAATGACAACACATGGACACAGG - Intergenic
1131578312 15:93614417-93614439 TATTGTCAACACAGTTACACTGG + Intergenic
1131861327 15:96656479-96656501 CAATGTGAACACATGGACACAGG - Intergenic
1133510556 16:6453306-6453328 TAATGAAAACACATGGACACAGG - Intronic
1133539241 16:6732622-6732644 TAATGTAAGGACAGTGACATTGG + Intronic
1134205738 16:12236744-12236766 TAATGTCAGCACAGGGCCAAGGG - Intronic
1136914827 16:34177637-34177659 TAATGAGAACACATGGACACAGG - Intergenic
1137334780 16:47537423-47537445 TCATGCCAGCTCAGGGAAACTGG + Intronic
1137777092 16:51065072-51065094 TAATGAGAACACATGGACACAGG - Intergenic
1138227717 16:55312024-55312046 AAATGTGAACACATGGACACAGG - Intergenic
1138929598 16:61636494-61636516 TAATGAAAACACATGGACACAGG + Intergenic
1139040341 16:62992563-62992585 CAATGGCAACACATGGACACAGG - Intergenic
1139228320 16:65254975-65254997 TAATGTCCAGACAGAGACACTGG - Intergenic
1139292265 16:65869714-65869736 TAATCTCAGCACAAGAACTCAGG + Intergenic
1140295683 16:73707537-73707559 CAATGAGAACACAGGGACACAGG + Intergenic
1140757624 16:78082463-78082485 CAATGACAGCACCTGGACACAGG + Intergenic
1140952670 16:79834061-79834083 TAATGAGAACACATGGACACAGG - Intergenic
1141978663 16:87535559-87535581 CAATGTCATCACAGGGATCCTGG - Intergenic
1142300412 16:89254523-89254545 CAATGAAAGCACATGGACACAGG - Intergenic
1142511093 17:393901-393923 TAAGCACAGCAAAGGGACACAGG + Intergenic
1142723849 17:1797402-1797424 TGTTGTCAGCACAGTCACACTGG + Intronic
1143223366 17:5280826-5280848 TAATGAGAACACATGGACACAGG - Intergenic
1143876251 17:9992798-9992820 CAATGAGAACACAGGGACACAGG - Intronic
1143876621 17:9996368-9996390 CAATGAGAACACAGGGACACAGG + Intronic
1145283777 17:21488408-21488430 CAATGAGAGCACATGGACACAGG + Intergenic
1145393663 17:22477090-22477112 CAATGAGAGCACATGGACACAGG - Intergenic
1145688271 17:26700597-26700619 CAATGAGATCACAGGGACACAGG + Intergenic
1145830497 17:27912335-27912357 CAATGAGAACACAGGGACACAGG - Intergenic
1146166929 17:30596984-30597006 CAATGAGAGCACATGGACACAGG - Intergenic
1146191100 17:30767178-30767200 GAATATCAGCACTGGGACCCTGG - Intergenic
1146336257 17:31973820-31973842 GAATATCAGCACTGGGACCCTGG - Intronic
1146507605 17:33418899-33418921 TAATGAGAACACACGGACACGGG + Intronic
1147682881 17:42264401-42264423 TAATGGGAACACATGGACACAGG - Intronic
1148236708 17:45974014-45974036 TTAAGACAGCACAGGGACTCTGG - Intronic
1148906754 17:50917264-50917286 AAATCACAGCACAGGGGCACAGG - Intergenic
1149049759 17:52290723-52290745 TAATGAAAACACATGGACACAGG + Intergenic
1149088031 17:52743115-52743137 TAATGAGAACACATGGACACAGG - Intergenic
1149109845 17:53015523-53015545 TGATGAGAGCACATGGACACAGG + Intergenic
1149915533 17:60605262-60605284 AAATGTCAGCACAGTGAAAAGGG + Intronic
1150869786 17:68893930-68893952 TAATGAGATCACATGGACACAGG - Intronic
1152127295 17:78454886-78454908 CGATGTCAGCACAGCAACACCGG + Intronic
1153043692 18:836926-836948 TAATGAGATCACATGGACACAGG - Intergenic
1153099071 18:1444454-1444476 TAATGAGAACACATGGACACAGG + Intergenic
1153282614 18:3428052-3428074 AAATGTCAGCACAGTGAAAAAGG - Intronic
1153522127 18:5963143-5963165 CCAAGTCAGCACAGGGACAGTGG + Intronic
1153640657 18:7154276-7154298 CAATGAGAGCACATGGACACAGG + Intergenic
1153731828 18:8021563-8021585 CAATGACAACACATGGACACAGG - Intronic
1154459018 18:14560757-14560779 CAATGAGAACACAGGGACACAGG - Intergenic
1155079138 18:22390327-22390349 TAATGGGAACACACGGACACAGG + Intergenic
1155115722 18:22764740-22764762 CAATGTGAACACATGGACACAGG + Intergenic
1155211497 18:23606078-23606100 AAATGTCAGCACAGTGAAAAAGG + Intronic
1155253521 18:23973575-23973597 TAATGAGAACACATGGACACAGG - Intergenic
1155359377 18:24984839-24984861 CGATGTCAGCACAGGGACTCTGG - Intergenic
1155433903 18:25791534-25791556 CAATGACAACACATGGACACAGG + Intergenic
1155771231 18:29702634-29702656 TAATGAGAACACATGGACACAGG + Intergenic
1155801575 18:30111424-30111446 TAATGAGAACACATGGACACAGG - Intergenic
1156754936 18:40512175-40512197 CAATGAGAACACAGGGACACAGG - Intergenic
1156805333 18:41172169-41172191 TAATGAGAACACATGGACACAGG - Intergenic
1156919340 18:42501464-42501486 TAATGAGAACACATGGACACAGG + Intergenic
1158030010 18:52951477-52951499 CAATGAGAACACAGGGACACAGG - Intronic
1158047003 18:53168512-53168534 CAATGAGAGCACATGGACACAGG + Intronic
1158047896 18:53178439-53178461 TAAAGTAACCACAGGGACTCAGG + Intronic
1158210551 18:55044790-55044812 TAATGAGAACACATGGACACAGG + Intergenic
1159409222 18:68049490-68049512 TAATGAGAACACATGGACACAGG + Intergenic
1159415145 18:68137361-68137383 CAATGACAACACATGGACACAGG - Intergenic
1159417166 18:68167733-68167755 CAATGACAACACATGGACACAGG - Intergenic
1159654992 18:71022629-71022651 TAATGTTATCACAGGGTCAGAGG - Intergenic
1159749238 18:72280038-72280060 CAATGACAGCACATGGACACAGG + Intergenic
1161570777 19:5029891-5029913 CACTCTCAGCACAGGGACTCAGG - Intronic
1162863991 19:13530049-13530071 TAATGAGAACACATGGACACAGG + Intronic
1163098508 19:15078803-15078825 CAATGAGAGCACATGGACACAGG + Intergenic
1163180716 19:15599223-15599245 CAATGAGAACACAGGGACACAGG + Intergenic
1163194745 19:15708460-15708482 TAATGAGATCACATGGACACAGG + Intergenic
1163365183 19:16872027-16872049 GAATGTCAACACAAGGAAACTGG + Intronic
1164093583 19:21983798-21983820 CAATGAGAACACAGGGACACAGG + Intronic
1164197534 19:22983802-22983824 CAACGACAACACAGGGACACAGG + Intronic
1164246083 19:23430325-23430347 TAATGAGAACACATGGACACAGG - Intergenic
1164331601 19:24263968-24263990 CAATGAGAGCACATGGACACAGG - Intergenic
1164349681 19:27320742-27320764 TAATGAGAACACATGGACACAGG + Intergenic
1164420248 19:28085062-28085084 CAATGAGAACACAGGGACACAGG + Intergenic
1164476143 19:28577454-28577476 GAAACTCAGCACAGGGACAGAGG + Intergenic
1164932399 19:32185863-32185885 TAATGAGAACACATGGACACAGG + Intergenic
1166027460 19:40100880-40100902 TAATGAGAACACATGGACACAGG + Intergenic
1168174384 19:54613342-54613364 CAATGAGAGCACATGGACACAGG + Intronic
1168502486 19:56905105-56905127 TAATGAGAACACATGGACACAGG - Intergenic
1202635859 1_KI270706v1_random:43558-43580 CAATGGGAACACAGGGACACAGG + Intergenic
925419370 2:3699202-3699224 TAATGGGAACACATGGACACTGG - Intronic
925479970 2:4259627-4259649 GAAAGGCAGCACAGGGACGCAGG - Intergenic
925557022 2:5142924-5142946 TAATGAGAACACATGGACACAGG + Intergenic
925719917 2:6817309-6817331 GAAACTCTGCACAGGGACACAGG + Intergenic
926000053 2:9323371-9323393 AAATGTCAACACAGGGGCAAAGG - Intronic
926319363 2:11738182-11738204 TAATGAGAACACATGGACACAGG + Intronic
926482901 2:13421980-13422002 TAATGCCAACACATGGACACAGG - Intergenic
926483691 2:13429829-13429851 TAATGAGAACACATGGACACAGG + Intergenic
927366963 2:22307896-22307918 CAATGAGAACACAGGGACACAGG + Intergenic
928682169 2:33713950-33713972 TAATGAGAACACATGGACACAGG + Intergenic
928775031 2:34750383-34750405 CAATGACAACACATGGACACAGG + Intergenic
929028688 2:37630043-37630065 TCATGTCAACACATTGACACAGG - Intergenic
929385196 2:41398454-41398476 TAATGTCAGCAAAGGAAAATGGG - Intergenic
929385301 2:41399686-41399708 TAATGTCAGCAAAGGAAAATGGG - Intergenic
929448286 2:42017600-42017622 CAATGAGAGCACATGGACACAGG + Intergenic
929817542 2:45246892-45246914 CAATGACAACACATGGACACAGG + Intergenic
930322584 2:49875254-49875276 CAATGAGAACACAGGGACACAGG - Intergenic
930392309 2:50777594-50777616 TAATGCCAGCACAGACACATTGG - Intronic
930624262 2:53679129-53679151 TATTGTCAGAACAGGGATAAAGG - Intronic
930941226 2:57016697-57016719 CAATGTGAACACATGGACACAGG - Intergenic
931560986 2:63560779-63560801 TAATGAGAACACATGGACACAGG + Intronic
931840092 2:66139142-66139164 CAATGAGAGCACATGGACACAGG - Intergenic
932508927 2:72265447-72265469 CAATGAAAACACAGGGACACAGG - Intronic
932795002 2:74686824-74686846 CAATGACAACACATGGACACAGG + Intergenic
932829024 2:74970299-74970321 CAATGACAACACATGGACACAGG - Intergenic
932868201 2:75369083-75369105 TAATGAGAACACATGGACACAGG - Intergenic
932966427 2:76480592-76480614 CAATGCGAGCACATGGACACAGG - Intergenic
933003061 2:76951825-76951847 CAATGACAACACATGGACACAGG - Intronic
933300646 2:80537119-80537141 CAATGACAACACATGGACACAGG - Intronic
933356175 2:81211658-81211680 CAATGAGAGCACATGGACACAGG + Intergenic
933529594 2:83490030-83490052 TAATGAGAACACATGGACACAGG + Intergenic
934592694 2:95570493-95570515 CAATGAGAACACAGGGACACAGG + Intergenic
934698356 2:96416854-96416876 CAATGAGAGCACATGGACACAGG - Intergenic
935246226 2:101220885-101220907 CAATGAGAACACAGGGACACAGG + Intronic
935815205 2:106841081-106841103 TAATGTCAGCACAGGGACACAGG + Intronic
935934869 2:108170791-108170813 CAATGAGAGCACATGGACACAGG - Intergenic
937199796 2:120193538-120193560 TAATGAGAACACATGGACACAGG + Intergenic
937650093 2:124310205-124310227 TAATGTCAACACAGGGTTCCAGG - Intronic
937652541 2:124336568-124336590 CAATGAGAGCACATGGACACAGG - Intronic
938191560 2:129286511-129286533 TATTGAGAGCACATGGACACAGG - Intergenic
939351986 2:141050541-141050563 CAATGTGAACACATGGACACAGG - Intronic
939358113 2:141130971-141130993 TAATGAGAACACATGGACACAGG + Intronic
939376445 2:141374952-141374974 AGATGTCAACACAAGGACACAGG - Intronic
939526704 2:143304401-143304423 CAATGAGAACACAGGGACACAGG + Intronic
939705070 2:145442549-145442571 CAATGAGAACACAGGGACACAGG + Intergenic
939724345 2:145697815-145697837 CAATGAGAACACAGGGACACAGG + Intergenic
939772823 2:146344360-146344382 CAATGTTAGCACAGGGTCACTGG + Intergenic
939981703 2:148790215-148790237 TAATGAGAACACACGGACACAGG - Intergenic
940096659 2:149983790-149983812 TAATGAGAGCACATGGACACGGG + Intergenic
940260919 2:151779035-151779057 CAATGAGAGCACATGGACACAGG + Intergenic
940379852 2:153001656-153001678 CAATGAGAACACAGGGACACAGG + Intergenic
940456347 2:153906439-153906461 TAATGAGAACACATGGACACAGG - Intronic
940786611 2:157988564-157988586 TCATGAGAACACAGGGACACAGG + Intronic
940985685 2:160049906-160049928 CAATGAGAGCACATGGACACAGG + Intronic
941040918 2:160622806-160622828 CAATGAGAACACAGGGACACAGG + Intergenic
941409164 2:165131795-165131817 TAATGAGAACACATGGACACAGG - Intronic
941554156 2:166954861-166954883 CAATGAGAACACAGGGACACAGG + Intronic
941715793 2:168761953-168761975 CAATGAGAACACAGGGACACAGG + Intronic
941840041 2:170072369-170072391 CAATGAGAACACAGGGACACAGG + Intronic
942074603 2:172345045-172345067 TAATGAGAACACATGGACACAGG - Intergenic
942490670 2:176486615-176486637 TAATGAGAACACATGGACACAGG - Intergenic
942543059 2:177034720-177034742 CAATGACAACACATGGACACAGG - Intergenic
942988814 2:182174938-182174960 TAATGAGAACACATGGACACAGG - Intronic
943240743 2:185380449-185380471 CAATGTGAACACATGGACACAGG + Intergenic
943380208 2:187135346-187135368 CAATGACAGCACATGGACACAGG - Intergenic
943413728 2:187572058-187572080 TAATGAGAACACATGGACACAGG - Intergenic
943465428 2:188223145-188223167 CAATGTGAACACATGGACACAGG - Intergenic
943478479 2:188388074-188388096 CAATGAGAACACAGGGACACAGG - Intronic
943652960 2:190477001-190477023 CAATGTGAACACATGGACACAGG + Intronic
943660896 2:190558269-190558291 TAATGAGAACACATGGACACAGG + Intergenic
943777370 2:191780996-191781018 CAATGAAAGCACATGGACACAGG - Intergenic
943978366 2:194512259-194512281 CAATGACAACACATGGACACAGG - Intergenic
944375380 2:199035486-199035508 TAATGAGAACACATGGACACAGG + Intergenic
944423986 2:199560262-199560284 CAATGAGAGCACATGGACACAGG - Intergenic
944752225 2:202721927-202721949 TAATGTCAGGCCAGGCACAGCGG - Intronic
945524539 2:210871871-210871893 CAATGAGAACACAGGGACACAGG + Intergenic
945648209 2:212527897-212527919 CAATGAGAACACAGGGACACAGG - Intronic
945927956 2:215825258-215825280 CAATGAGAACACAGGGACACAGG + Intergenic
945928549 2:215830895-215830917 TAATGAGAACACATGGACACAGG - Intergenic
945945760 2:215994359-215994381 AAATGAGAACACAGGGACACGGG + Intronic
946547326 2:220758793-220758815 CAATGAGAACACAGGGACACAGG + Intergenic
946809138 2:223504369-223504391 CAATGACAACACATGGACACAGG + Intergenic
946832390 2:223739993-223740015 TAATGAGAACACATGGACACAGG + Intergenic
947074580 2:226328557-226328579 CAATGAGAACACAGGGACACAGG + Intergenic
947449745 2:230196736-230196758 CAATGAGAGCACATGGACACAGG - Intronic
947484101 2:230531365-230531387 TAATGAGAACACATGGACACAGG + Intronic
947492711 2:230609920-230609942 CAATGAGAGCACATGGACACAGG + Intergenic
947550085 2:231039120-231039142 TAATGAGAACACATGGACACAGG + Intronic
947643334 2:231719710-231719732 TAATGTCAGGCCAGGCACAGTGG - Intergenic
947719395 2:232361033-232361055 TAATGAGAACACATGGACACAGG + Intergenic
1168731040 20:80824-80846 TAATGAGAACACATGGACACAGG + Intergenic
1168987409 20:2062049-2062071 CAATGACAACACATGGACACAGG + Intergenic
1169418471 20:5438797-5438819 CAATGAGAACACAGGGACACAGG - Intergenic
1169576574 20:6968964-6968986 CAATGGGAGCACATGGACACAGG - Intergenic
1169610180 20:7370542-7370564 CAATGTGAGCACATAGACACAGG + Intergenic
1170803438 20:19609610-19609632 TAATGAAAACACATGGACACAGG - Intronic
1171075711 20:22120872-22120894 CAATGAGAACACAGGGACACTGG + Intergenic
1171247344 20:23622228-23622250 TAATGAGAACACATGGACACAGG - Intergenic
1171440505 20:25157554-25157576 TAATGAGAACACATGGACACAGG - Intergenic
1171768694 20:29304020-29304042 CAATGAGAGCACATGGACACAGG - Intergenic
1171786067 20:29465672-29465694 TAATGAGAACACAGGGACACAGG - Intergenic
1172271551 20:33658252-33658274 TGAATACAGCACAGGGACACAGG - Intronic
1173188692 20:40860269-40860291 TAATACCAGCAAAGGGGCACAGG + Intergenic
1174317701 20:49715160-49715182 ATATGTCTACACAGGGACACTGG - Intergenic
1174966347 20:55220499-55220521 CAATGAGATCACAGGGACACAGG - Intergenic
1174980712 20:55391422-55391444 TAATGAGAACACAAGGACACAGG - Intergenic
1174997011 20:55581394-55581416 CAATGAGAACACAGGGACACAGG + Intergenic
1175309594 20:58002641-58002663 CAATGAGAACACAGGGACACAGG + Intergenic
1175668581 20:60881473-60881495 CAATGAGAGCACATGGACACAGG - Intergenic
1175818448 20:61895865-61895887 TGATGTCAGCACTGCCACACGGG - Intronic
1175892227 20:62320999-62321021 TGAGGTCAGCTTAGGGACACAGG + Intronic
1176815122 21:13592582-13592604 CAATGAGAACACAGGGACACAGG + Intergenic
1177170741 21:17653084-17653106 CAATGAGAGCACACGGACACAGG + Intergenic
1177251604 21:18598684-18598706 CAATGACAACACATGGACACAGG - Intergenic
1177399051 21:20578223-20578245 CAATGAGATCACAGGGACACAGG - Intergenic
1177533505 21:22395724-22395746 CAATGAGAGCACATGGACACAGG + Intergenic
1177715476 21:24835397-24835419 TAAAGTCATCACATGTACACTGG + Intergenic
1178965682 21:37114979-37115001 CAATGAGAGCACATGGACACAGG + Intronic
1179059120 21:37963513-37963535 CAATGAAAACACAGGGACACAGG - Intronic
1179237075 21:39557087-39557109 TAATGAGAACACATGGACACAGG - Intronic
1180575699 22:16771915-16771937 CAATGAGAACACAGGGACACAGG + Intergenic
1181422639 22:22812273-22812295 TAATCATAGCACAGTGACACTGG + Intronic
1181898587 22:26133089-26133111 CAATGAGAACACAGGGACACAGG - Intergenic
1182152838 22:28042528-28042550 TAATGAGAACACATGGACACAGG + Intronic
1182832958 22:33318544-33318566 TATTGTAGTCACAGGGACACAGG + Intronic
1183706546 22:39478121-39478143 GAAGGTGAGCACAGGGAGACGGG + Intronic
1184395433 22:44233417-44233439 CAATGAGAACACAGGGACACAGG - Intergenic
949154819 3:815190-815212 CAATGACAACACATGGACACAGG + Intergenic
949440746 3:4077603-4077625 CAATGAGAGCACATGGACACAGG + Intronic
949689500 3:6619714-6619736 TATTGTCAGCACAGGGACATGGG + Intergenic
950253279 3:11484737-11484759 CAATGACAACACATGGACACAGG - Intronic
950628586 3:14266658-14266680 GAATGTCAGTACAGGGACTGAGG + Intergenic
950758199 3:15195527-15195549 TAATGTGAATACATGGACACAGG + Intergenic
951139548 3:19145716-19145738 TCATGACAACACATGGACACAGG - Intergenic
951721019 3:25698439-25698461 TAATGGGAACACATGGACACAGG - Intergenic
951838442 3:27007029-27007051 TAATGAGAACACATGGACACAGG + Intergenic
951856645 3:27204503-27204525 CAATGAGATCACAGGGACACAGG - Intronic
952000098 3:28775175-28775197 CAATGAGAACACAGGGACACAGG - Intergenic
952556797 3:34540838-34540860 CAATGAGAACACAGGGACACAGG + Intergenic
952575554 3:34770061-34770083 TAATGAGAACACATGGACACAGG + Intergenic
952813467 3:37425549-37425571 CAATGACAACACATGGACACAGG - Intronic
952842060 3:37654886-37654908 CAATGACAACACAGGGACACAGG - Intronic
952935794 3:38397403-38397425 TAAGGTCAGCACAGGGACATGGG + Intronic
953052041 3:39353416-39353438 CAATGAGAACACAGGGACACAGG + Intergenic
953115340 3:39987201-39987223 TAATGAGAACACATGGACACAGG - Intronic
953217617 3:40935550-40935572 TAATGAGATCACATGGACACAGG - Intergenic
953265875 3:41387567-41387589 CAATGAGAGCACATGGACACAGG - Intronic
953459399 3:43070582-43070604 CAATGTGATCACATGGACACAGG + Intergenic
954213292 3:49110327-49110349 TGATGACAGCACAGTGACAACGG - Exonic
955049378 3:55394613-55394635 CAATGAAAGCACATGGACACAGG + Intergenic
955116977 3:56015405-56015427 CAATGTGAACACATGGACACAGG - Intronic
955424273 3:58771197-58771219 TAATGAGAACACATGGACACAGG + Intronic
956512242 3:70006841-70006863 CAATGAGAGCACATGGACACAGG - Intergenic
956566569 3:70645171-70645193 CAATGAGAACACAGGGACACAGG - Intergenic
957104442 3:75868553-75868575 CAATGAGAACACAGGGACACAGG + Intergenic
957121621 3:76101798-76101820 TAATGGGAACACAGGGACACAGG - Intronic
957222508 3:77402233-77402255 TAATGATAACACATGGACACAGG + Intronic
957330220 3:78753730-78753752 TAATGAGAACACATGGACACAGG - Intronic
957590581 3:82192371-82192393 TAATGAGAACACACGGACACAGG + Intergenic
957699583 3:83691222-83691244 CAATGAGAGCACATGGACACAGG + Intergenic
958007240 3:87827292-87827314 CAATGACAACACATGGACACAGG - Intergenic
958091496 3:88882447-88882469 CAATGTGAACACATGGACACAGG + Intergenic
958101614 3:89019302-89019324 CAATGAGAGCACATGGACACAGG + Intergenic
958155064 3:89746189-89746211 TAATGAGAACACATGGACACAGG - Intergenic
958166949 3:89888299-89888321 TAATGAGAACACATGGACACAGG + Intergenic
958170900 3:89939278-89939300 TAATGAGATCACATGGACACAGG - Intergenic
958403749 3:93726274-93726296 CAATGACATCACATGGACACAGG - Intergenic
958496629 3:94851823-94851845 TAATGAGATCACATGGACACAGG + Intergenic
958677344 3:97282783-97282805 CAATGACAACACATGGACACAGG + Intronic
958698314 3:97555124-97555146 CAATGAGAGCACATGGACACAGG - Intronic
958794100 3:98687804-98687826 TAATGAGAACACATGGACACAGG + Intergenic
958975869 3:100667370-100667392 TGATGAGAGCACATGGACACAGG - Intronic
959046178 3:101476293-101476315 CAATGAGAGCACATGGACACAGG - Intronic
960128267 3:114024647-114024669 CAATGAGAACACAGGGACACAGG + Intronic
960847502 3:122018338-122018360 TAATGAGAACACATGGACACAGG + Intronic
962340451 3:134577816-134577838 CAATGAGAACACAGGGACACAGG - Intergenic
962667231 3:137666510-137666532 TAATGAGAACACATGGACACAGG + Intergenic
962756536 3:138469272-138469294 TAATGACAGCCCAGGGGGACTGG + Intronic
963270938 3:143285277-143285299 TAATGAGAACACATGGACACAGG - Intronic
963402320 3:144815003-144815025 TAATGAGAACACATGGACACAGG - Intergenic
963505730 3:146182362-146182384 TAATGAGAACACATGGACACAGG - Intergenic
964327295 3:155561327-155561349 CAATGAGAGCACATGGACACAGG - Intronic
964563660 3:158025492-158025514 CAATGACATCACATGGACACAGG + Intergenic
964581650 3:158246194-158246216 CAATGAGAACACAGGGACACAGG + Intronic
964761469 3:160138408-160138430 CAATGACAGCACATGGACACAGG + Intergenic
964815488 3:160713456-160713478 CAATGAGAGCACATGGACACAGG + Intergenic
964962718 3:162447869-162447891 TAATGAGAACACATGGACACAGG - Intergenic
965004754 3:163005890-163005912 CAATGTGAACACATGGACACAGG + Intergenic
965618145 3:170615506-170615528 TAATGAGAACACATGGACACAGG - Intronic
965650276 3:170925131-170925153 TAATGAGAACACATGGACACAGG - Intergenic
966094537 3:176184107-176184129 TAATAGCGGCACATGGACACAGG + Intergenic
966128255 3:176605859-176605881 CAATGAGAACACAGGGACACAGG + Intergenic
966450594 3:180055993-180056015 CAATGAGAACACAGGGACACAGG + Intergenic
966589726 3:181668784-181668806 CAATGACAACACATGGACACAGG + Intergenic
967568796 3:191003056-191003078 TAATGAGAACACATGGACACAGG - Intergenic
967707248 3:192665553-192665575 CAATGAGAACACAGGGACACAGG + Intronic
967744328 3:193037877-193037899 TAATGAGAACACATGGACACAGG - Intergenic
967804792 3:193705901-193705923 GAATGTCAGCACAGTGAAAAGGG - Intergenic
968784216 4:2607386-2607408 GAATGTCAGCACAGTGAAAAAGG + Intronic
969798309 4:9542867-9542889 TAATGAGAACACATGGACACAGG - Intergenic
969841339 4:9884966-9884988 TAATGAGAACACATGGACACAGG + Intronic
969903686 4:10373364-10373386 CAATGACAACACATGGACACAGG + Intergenic
970062624 4:12051771-12051793 CAATGTTAACACATGGACACAGG + Intergenic
970181489 4:13401324-13401346 TAATGAGAACACATGGACACAGG + Intronic
970225983 4:13857180-13857202 CAATGAGAGCACATGGACACAGG - Intergenic
970326858 4:14934869-14934891 TCATGTCAGCAGAGACACACGGG - Intergenic
970566757 4:17339074-17339096 CAATGAGAGCACATGGACACAGG - Intergenic
970687108 4:18580932-18580954 TAATGAGAACACATGGACACAGG - Intergenic
970753794 4:19398851-19398873 CAATGTGAACACATGGACACAGG + Intergenic
971249588 4:24962680-24962702 TAATGAGAACACATGGACACAGG + Intronic
971461559 4:26904139-26904161 TAATGAGAACACATGGACACAGG - Intronic
971489617 4:27197892-27197914 CAATGAGAGCACATGGACACAGG + Intergenic
971510870 4:27421671-27421693 CAATGAGAACACAGGGACACAGG - Intergenic
971691990 4:29848829-29848851 TAATCCCAGCACAGGGAGTCCGG + Intergenic
971782060 4:31049193-31049215 CAATGAGAGCACATGGACACAGG - Intronic
972219836 4:36941534-36941556 CAATGACAGCACATGGACACAGG + Intergenic
972229399 4:37053956-37053978 CAATGAGAGCACATGGACACAGG - Intergenic
972260027 4:37398397-37398419 CAATGAGAGCACATGGACACAGG + Intronic
972358687 4:38306033-38306055 TCATTTCATCACAGGGACAATGG - Intergenic
972479607 4:39485291-39485313 CACTGTCAGCGAAGGGACACTGG - Intergenic
972742432 4:41900776-41900798 CAATGAGAGCACATGGACACAGG - Intergenic
973028392 4:45303591-45303613 CAATGAGAGCACATGGACACAGG - Intergenic
973147248 4:46842595-46842617 TAATGAGAACACATGGACACAGG - Intronic
973305110 4:48638903-48638925 TAATGAGAACAAAGGGACACAGG + Intronic
973592029 4:52452268-52452290 CAATGAGAGCACATGGACACAGG + Intergenic
973654875 4:53036253-53036275 TAATGAGAACACATGGACACAGG - Intronic
973920811 4:55682865-55682887 CAATGAGAACACAGGGACACAGG - Intergenic
974150844 4:58007456-58007478 CAATGAGAGCACATGGACACAGG - Intergenic
974266515 4:59592805-59592827 TAATGAGAACACATGGACACAGG + Intergenic
974276080 4:59722772-59722794 CAATGAGAACACAGGGACACAGG + Intergenic
974281807 4:59804859-59804881 AAATGAGAACACAGGGACACAGG - Intergenic
974302559 4:60086994-60087016 TAATGAGAACACATGGACACAGG + Intergenic
974359157 4:60853568-60853590 TAATGAGAACACATGGACACAGG + Intergenic
974536215 4:63179028-63179050 CAATGAGAACACAGGGACACAGG - Intergenic
974672634 4:65052355-65052377 TAATGAGATCACATGGACACAGG - Intergenic
974705184 4:65506044-65506066 CAATGACAACACATGGACACAGG - Intronic
974837482 4:67268394-67268416 TAATGAGAACACATGGACACAGG - Intergenic
975075622 4:70205005-70205027 TAATGAGAACACATGGACACAGG + Intergenic
975619819 4:76285057-76285079 TAATGAGAACACATGGACACAGG - Intronic
976396219 4:84558406-84558428 TAATGAGAACACATGGACACAGG - Intergenic
976555406 4:86445366-86445388 TAATGAGAACACATGGACACAGG + Intronic
976687083 4:87825881-87825903 TAATGAGAACACATGGACACAGG - Intronic
977064328 4:92294710-92294732 CAATGTGAACACATGGACACAGG - Intergenic
977108145 4:92916554-92916576 TAATGAGAACACATGGACACAGG - Intronic
977108832 4:92924196-92924218 CAATGACAACACATGGACACAGG + Intronic
977109554 4:92935832-92935854 TAATGAGAACACATGGACACAGG + Intronic
977109757 4:92938758-92938780 TAATGAGAACACATGGACACAGG - Intronic
977191339 4:94004616-94004638 TAATGAGAACACATGGACACAGG + Intergenic
977293673 4:95190287-95190309 CAATGAGAACACAGGGACACAGG + Intronic
977363362 4:96034729-96034751 CAATGAGAACACAGGGACACAGG + Intergenic
977515662 4:98018211-98018233 TAATGAGAACACATGGACACAGG - Intronic
977840566 4:101698151-101698173 TGATGTCATCACAGGCACAGGGG + Intronic
978050554 4:104194144-104194166 TAATGAGAACACATGGACACAGG - Intergenic
978078378 4:104562324-104562346 CAATGAGAACACAGGGACACAGG - Intergenic
978179001 4:105770566-105770588 TAATGAGAACACATGGACACAGG - Intronic
978312368 4:107398714-107398736 AAATGTCAGCTCAGGCAGACAGG + Intergenic
978730914 4:112025496-112025518 CAATGAGAGCACATGGACACAGG + Intergenic
979086157 4:116411905-116411927 CAATGAGAGCACATGGACACAGG + Intergenic
979188311 4:117826499-117826521 AAATGTGAGCACAGGCTCACAGG - Intergenic
979639607 4:122998505-122998527 TAATGAGAACACATGGACACAGG - Intronic
980139826 4:128901468-128901490 CAATGAGAACACAGGGACACAGG + Intronic
980205570 4:129715685-129715707 CAATGACAACACATGGACACAGG - Intergenic
980380354 4:132006010-132006032 CAATGACAACACATGGACACAGG + Intergenic
980503462 4:133685371-133685393 CAATGACAACACTGGGACACAGG - Intergenic
980633403 4:135468176-135468198 CAATGAGAGCACATGGACACAGG - Intergenic
980756720 4:137173825-137173847 TAATGAGAACAGAGGGACACAGG + Intergenic
980867553 4:138571049-138571071 CAATGAGAACACAGGGACACAGG + Intergenic
980867732 4:138573077-138573099 TAATGAGAACACATGGACACAGG - Intergenic
981149273 4:141362601-141362623 TAATGAGAACACATGGACACAGG - Intergenic
981367574 4:143920742-143920764 CAATGACAACACATGGACACAGG - Intergenic
981391855 4:144200257-144200279 TAATGAGAACACATGGACACAGG + Intergenic
981839954 4:149100147-149100169 TGATGTAAACAAAGGGACACTGG + Intergenic
982181291 4:152750959-152750981 TAATGAGAACACATGGACACAGG + Intronic
982603577 4:157484523-157484545 TAATGAGAACACATGGACACAGG - Intergenic
982831074 4:160061361-160061383 TAATGAGAACACATGGACACAGG - Intergenic
983134297 4:164061478-164061500 TAATGAGAACACATGGACACAGG + Intronic
983217741 4:165017773-165017795 CAATGAGAACACAGGGACACAGG - Intergenic
983377953 4:166953882-166953904 CAATGAGAACACAGGGACACAGG + Intronic
983440767 4:167781182-167781204 CAATGAGAACACAGGGACACAGG - Intergenic
983484264 4:168315620-168315642 CAATGAGAGCACATGGACACAGG - Intronic
983613046 4:169671394-169671416 CAATGAGAGCACATGGACACAGG + Intronic
984163252 4:176279599-176279621 CAATGTGAACACATGGACACAGG - Intergenic
984310618 4:178053370-178053392 CAATGTGAACACATGGACACAGG + Intergenic
984359435 4:178710001-178710023 TAATGAGAACACATGGACACAGG + Intergenic
984477145 4:180249979-180250001 CAATGACAACACATGGACACAGG + Intergenic
984521773 4:180810741-180810763 TAATTACAGCAAAGGAACACTGG + Intergenic
984545554 4:181097640-181097662 TATTGTCAGCACTTGGACAACGG - Intergenic
984854496 4:184182804-184182826 CAATGACAACACATGGACACAGG + Intronic
985038615 4:185866205-185866227 TAATCTCAGCACTGGTACTCAGG - Intronic
985050521 4:185986607-185986629 CAATGAGAACACAGGGACACAGG - Intergenic
985380810 4:189392686-189392708 CAATGACAACACATGGACACAGG - Intergenic
985935058 5:3091179-3091201 TAATGAGAACACATGGACACAGG - Intergenic
986030993 5:3892399-3892421 TAATGAGAACACATGGACACAGG + Intergenic
986484876 5:8225970-8225992 CAATGACAACACATGGACACAGG + Intergenic
986511396 5:8510272-8510294 TAATGAGAACACAGGGACACAGG - Intergenic
986655843 5:10011239-10011261 CAATGAGAGCACATGGACACAGG - Intergenic
986793633 5:11188405-11188427 CAATGGGAGCACATGGACACAGG + Intronic
987419382 5:17700865-17700887 CAATGAGAGCACATGGACACAGG + Intergenic
987618800 5:20311592-20311614 CAATGAGAACACAGGGACACAGG + Intronic
987787819 5:22525003-22525025 TAATGAGAACACATGGACACAGG - Intronic
988044683 5:25935459-25935481 TAATGAGAACACAGGGACACAGG - Intergenic
988062003 5:26183238-26183260 CAATGACAACACATGGACACAGG - Intergenic
988254565 5:28805021-28805043 TAATGAGAACACATGGACACAGG + Intergenic
988607381 5:32690461-32690483 TGATGTCCGCACAGGGAGACTGG - Intronic
988630962 5:32931110-32931132 CAATGGGAGCACATGGACACAGG - Intergenic
988647504 5:33110314-33110336 CAATGGCAACACATGGACACAGG - Intergenic
988699638 5:33660706-33660728 GAATGTAAGCACGGGGACTCTGG - Intronic
988939639 5:36129984-36130006 TAATGAGAACACATGGACACAGG + Intronic
989100851 5:37821748-37821770 TAATGTCATCCCAGGAACAAAGG + Intronic
989102010 5:37832320-37832342 AAATGTCAGCACTGTGACAGAGG + Intronic
989223030 5:38990289-38990311 TAATGAGAACACATGGACACAGG + Intronic
989259582 5:39404191-39404213 CAATGAGAGCACATGGACACAGG + Intronic
989386188 5:40856666-40856688 CAATGAGATCACAGGGACACAGG - Intronic
989552269 5:42749827-42749849 CAATGTGAACACATGGACACAGG - Intergenic
989697676 5:44222768-44222790 TAATGAGAACACATGGACACAGG + Intergenic
990050353 5:51492482-51492504 TACTGTGAGCACAAGGACAATGG + Intergenic
990945448 5:61244790-61244812 TAATGAGAACACATGGACACAGG + Intergenic
991009560 5:61868704-61868726 CAATGAGAACACAGGGACACAGG - Intergenic
991161921 5:63513226-63513248 CAATGTGAACACATGGACACAGG + Intergenic
991169056 5:63599679-63599701 CAATGAGAACACAGGGACACAGG - Intergenic
991213015 5:64129286-64129308 CAATGAGATCACAGGGACACAGG - Intergenic
992335403 5:75762878-75762900 CAATGAGAGCACATGGACACAGG - Intergenic
992767735 5:80016851-80016873 TAGTGTCAGCACAGGGAGTGTGG - Intronic
992921539 5:81527683-81527705 TAATGAGAACACATGGACACAGG + Intronic
993008235 5:82451431-82451453 TAATGATAACACATGGACACAGG - Intergenic
993163499 5:84319948-84319970 TAATGAAAACACATGGACACAGG + Intronic
993287821 5:86022972-86022994 CAATGAGAGCACATGGACACAGG - Intergenic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
993952913 5:94198545-94198567 CAATGAGAACACAGGGACACAGG + Intronic
994137426 5:96303644-96303666 TAATGAGAACACATGGACACAGG - Intergenic
994208888 5:97065761-97065783 TAATGTCAGCAAAGCCACATCGG - Intergenic
994329960 5:98492881-98492903 CAATGAGAGCACATGGACACAGG + Intergenic
994390445 5:99186176-99186198 TAATGAGAACACATGGACACAGG - Intergenic
994504756 5:100628565-100628587 CAATGAGAGCACATGGACACAGG - Intergenic
994575274 5:101570040-101570062 TAATGAGAGCACATGGACACAGG - Intergenic
994963733 5:106639200-106639222 TAATGAGAACACATGGACACAGG + Intergenic
995267924 5:110186322-110186344 CAATGAGAACACAGGGACACAGG - Intergenic
995365523 5:111355696-111355718 CAATGAGAGCACATGGACACAGG - Intronic
995455453 5:112347278-112347300 AAATGTCAACACAGTGAAACAGG - Intronic
996006432 5:118426460-118426482 TAATGTGAACACATAGACACAGG + Intergenic
996012431 5:118495830-118495852 CAATGAGAACACAGGGACACAGG + Intergenic
996181022 5:120420500-120420522 TAATGAGAACACATGGACACAGG - Intergenic
996267106 5:121554931-121554953 TAATGAGAACACATGGACACAGG - Intergenic
996752590 5:126904007-126904029 CAATGTGAACACATGGACACAGG - Intronic
996951934 5:129137471-129137493 TGATGAGAACACAGGGACACAGG + Intergenic
996989572 5:129612167-129612189 TAATGAGAACACATGGACACAGG - Intronic
997045213 5:130307707-130307729 CAATGAGAACACAGGGACACAGG - Intergenic
997089572 5:130841433-130841455 CAATGTGAACACATGGACACAGG - Intergenic
997220866 5:132162306-132162328 CAATGACAACACATGGACACAGG + Intergenic
997276990 5:132601924-132601946 CAATGAGAGCACATGGACACAGG + Intronic
997922700 5:137997849-137997871 AAATGTCAGCACAGTGAAAAAGG - Intronic
998309342 5:141111557-141111579 TAATGAGAACACATGGACACAGG - Intronic
998668343 5:144324873-144324895 TAATGATAACACATGGACACAGG + Intronic
998694498 5:144624006-144624028 TAATGAAAACACATGGACACAGG - Intergenic
998751572 5:145327978-145328000 CAATGAGAACACAGGGACACCGG - Intergenic
998819432 5:146044857-146044879 TAATGTCATCACAAGCCCACAGG + Intronic
999514880 5:152290938-152290960 CAATGAGAACACAGGGACACAGG - Intergenic
999558863 5:152776780-152776802 TAATGACAACACTTGGACACAGG + Intergenic
999897221 5:156048016-156048038 CAATGACAACACATGGACACAGG - Intronic
999951572 5:156657440-156657462 TAATGAGAACACATGGACACAGG - Intronic
1000061914 5:157665395-157665417 TAATGAGAACACATGGACACAGG + Intronic
1000150321 5:158494093-158494115 TAATGAGAACACATGGACACAGG - Intergenic
1000283739 5:159807457-159807479 CAATGAGAACACAGGGACACAGG + Intergenic
1001357384 5:171041937-171041959 TAATGAGAACACATGGACACAGG - Intronic
1001368815 5:171174994-171175016 CAATGACAACACATGGACACAGG - Intronic
1001369091 5:171178215-171178237 CAATGACAACACATGGACACAGG - Intronic
1001904422 5:175459867-175459889 TAATGAGAACACATGGACACAGG + Intergenic
1002378288 5:178804759-178804781 TTATGTGAGCACAGGTACAGAGG - Intergenic
1002909172 6:1475793-1475815 TAATGAGAACACATGGACACAGG + Intergenic
1003229180 6:4234917-4234939 TAATGAGAACACATGGACACAGG + Intergenic
1003442424 6:6155522-6155544 AAGTGTCAGAAAAGGGACACTGG - Intronic
1003473084 6:6454956-6454978 TAATGAGAACACATGGACACAGG - Intergenic
1003759493 6:9160842-9160864 GAATGAGAACACAGGGACACAGG + Intergenic
1003999875 6:11587663-11587685 TAATGAGAACACATGGACACAGG - Intergenic
1004190616 6:13460612-13460634 TAATGAGAACACATGGACACAGG + Intronic
1004304200 6:14485923-14485945 CAATGACAACACATGGACACAGG + Intergenic
1004352389 6:14901760-14901782 CAATCAGAGCACAGGGACACAGG + Intergenic
1004535916 6:16501518-16501540 TAATGAGAACACATGGACACAGG - Intronic
1004785906 6:18966961-18966983 TAATGAGAACACATGGACACAGG - Intergenic
1004808140 6:19226764-19226786 CAATGACAACACATGGACACAGG + Intergenic
1005239760 6:23810248-23810270 CAATGAGAGCACATGGACACAGG + Intergenic
1005261204 6:24062627-24062649 TAATGAGAACACATGGACACAGG - Intergenic
1005769936 6:29058776-29058798 TAATGAGAACACATGGACACAGG - Intergenic
1005858527 6:29883440-29883462 TAATGAGAACACATGGACACAGG + Intergenic
1006200486 6:32284589-32284611 CAATGACAACACATGGACACGGG + Intergenic
1007049202 6:38808887-38808909 TAATGAGAACACATGGACACAGG + Intronic
1007964958 6:45995909-45995931 TAATGAGAACACATGGACACAGG + Intronic
1008233033 6:49008739-49008761 TAATGAGAACACATGGACACAGG - Intergenic
1008474170 6:51918392-51918414 CAATGACAACACATGGACACAGG - Intronic
1008736841 6:54555428-54555450 CAATGTGAACACATGGACACAGG + Intergenic
1008763456 6:54881957-54881979 CAATGAGAACACAGGGACACAGG - Intronic
1008989234 6:57583372-57583394 TAATGAGAACACATGGACACAGG - Intronic
1009263459 6:61525184-61525206 TAATGAGAACACATGGACACAGG + Intergenic
1009512840 6:64574223-64574245 CAATGGGAACACAGGGACACAGG + Intronic
1009899469 6:69794158-69794180 AAATGTCAGCACAGTGAAAAAGG - Intronic
1010262794 6:73835577-73835599 TAATGAGATCACATGGACACAGG - Intergenic
1010377022 6:75182405-75182427 TAATGAGAACACATGGACACAGG - Intronic
1010460199 6:76105809-76105831 CAATGTGATCACATGGACACAGG - Intergenic
1010565486 6:77407088-77407110 CAATGAGAGCACATGGACACAGG + Intergenic
1010592851 6:77730821-77730843 CAATGAGAACACAGGGACACAGG - Intronic
1010595121 6:77754047-77754069 CAATGAAAGCACATGGACACAGG + Intronic
1010708189 6:79139471-79139493 CAATGACAACACATGGACACAGG + Intergenic
1011006479 6:82651280-82651302 CAATGAGAACACAGGGACACAGG + Intergenic
1011062487 6:83287347-83287369 CAATGGGAGCACATGGACACAGG - Intronic
1011103537 6:83752412-83752434 CAATGAGAGCACATGGACACAGG - Intergenic
1011164979 6:84436731-84436753 TAATGAGAACACATGGACACAGG + Intergenic
1011234441 6:85200616-85200638 CAATGTGAACACATGGACACAGG - Intergenic
1011308129 6:85951977-85951999 CAATGAGAACACAGGGACACAGG + Intergenic
1011365341 6:86575509-86575531 CAATGAGAACACAGGGACACAGG + Intergenic
1011446597 6:87448149-87448171 TAATGAAAACACATGGACACAGG - Intronic
1011619117 6:89225458-89225480 CAATGAGATCACAGGGACACAGG - Intronic
1011657609 6:89565955-89565977 TAATGGCAGCCCAGGTATACTGG + Intronic
1011693972 6:89895476-89895498 CACTGCCAGCCCAGGGACACGGG - Exonic
1011843186 6:91527563-91527585 TAATGAGAACACATGGACACAGG - Intergenic
1012000419 6:93647301-93647323 CAATGAGAGCACATGGACACAGG - Intergenic
1012020276 6:93909247-93909269 CAATGAGAGCACATGGACACAGG + Intergenic
1012207314 6:96477653-96477675 AAATGACAACACATGGACACAGG - Intergenic
1012364626 6:98423540-98423562 CAATGAGAGCACATGGACACAGG - Intergenic
1012384525 6:98663599-98663621 CAATGAGAGCACATGGACACAGG - Intergenic
1012641745 6:101626125-101626147 TAATGTCAGGGGAGGGAGACAGG - Intronic
1013117728 6:107115316-107115338 TCATTTCCGCACAAGGACACAGG + Intergenic
1013387930 6:109651028-109651050 CAATGACAACACATGGACACAGG + Intronic
1013725194 6:113086658-113086680 TAATGAGAACACATGGACACAGG + Intergenic
1013750584 6:113401057-113401079 CAATGAGAACACAGGGACACAGG + Intergenic
1013762734 6:113536933-113536955 CAATGGCATCACATGGACACAGG + Intergenic
1014132619 6:117851878-117851900 CAATGAGAGCACATGGACACGGG - Intergenic
1014571446 6:123013854-123013876 CAATGAGAGCACATGGACACAGG - Intronic
1014580042 6:123126032-123126054 TAATGAGAACACATGGACACAGG - Intergenic
1014693405 6:124589871-124589893 TAATGAGAACACATGGACACAGG - Intronic
1014713258 6:124834201-124834223 TAATGAGAACACATGGACACAGG + Intergenic
1014843202 6:126243729-126243751 TAATGAGAACACATGGACACAGG + Intergenic
1015462467 6:133507569-133507591 TAATGAGAACACATGGACACAGG - Intronic
1015719335 6:136225290-136225312 CAATGAGAGCACATGGACACAGG + Intergenic
1016106085 6:140164072-140164094 TAATGAGAACACATGGACACAGG + Intergenic
1016146782 6:140687497-140687519 CAATGACAACACATGGACACAGG - Intergenic
1016184496 6:141182458-141182480 CAATGAAAACACAGGGACACAGG + Intergenic
1016188942 6:141236121-141236143 CAATGAGAACACAGGGACACAGG + Intergenic
1016575133 6:145561847-145561869 TAATGAGAACACATGGACACAGG + Intronic
1017221140 6:151967378-151967400 TAATGAGAACACATGGACACAGG - Intronic
1017474907 6:154780566-154780588 CAATGACAACACATGGACACAGG - Intronic
1017664223 6:156703700-156703722 CAGTGTCTGCCCAGGGACACAGG - Intergenic
1018044627 6:159954903-159954925 TAATGACAGAACTGGGACCCAGG - Intergenic
1018274409 6:162115292-162115314 TAATGAGAACACATGGACACAGG + Intronic
1018616996 6:165696019-165696041 TAATGTCACCCCAGGGTAACTGG + Intronic
1019203078 6:170335251-170335273 CAATGAGAGCACACGGACACAGG - Intronic
1019753481 7:2749458-2749480 CAATGACAACACATGGACACGGG + Intronic
1020671598 7:11122055-11122077 TAATGAGAACACATGGACACAGG - Intronic
1020815801 7:12904129-12904151 TAATGAAAACACATGGACACAGG + Intergenic
1020873744 7:13668265-13668287 CAATGAGAACACAGGGACACAGG - Intergenic
1021297149 7:18922025-18922047 TAATGAGAACACATGGACACAGG + Intronic
1021305704 7:19029287-19029309 CAATGAGAACACAGGGACACAGG + Intronic
1022598870 7:31738062-31738084 TGATGCCAGCACTGGGGCACAGG - Intergenic
1022686414 7:32601519-32601541 TAATGAAAACACATGGACACAGG + Intergenic
1022695144 7:32697844-32697866 TAATGAGATCACATGGACACAGG - Intergenic
1022868350 7:34446817-34446839 TAATGAGAACACACGGACACAGG + Intergenic
1023132247 7:37014669-37014691 CAATGAGAACACAGGGACACAGG - Intronic
1023815571 7:43947072-43947094 CAATGAGAACACAGGGACACAGG - Intronic
1023979375 7:45058513-45058535 CAATGACAACACATGGACACAGG - Intronic
1024480645 7:49858502-49858524 CAATGACAACACACGGACACAGG + Intronic
1024577646 7:50777862-50777884 CAATGAGAGCACATGGACACAGG + Intronic
1024682486 7:51707445-51707467 GAATGAGAACACAGGGACACTGG - Intergenic
1024784806 7:52895136-52895158 TAATGGGAACACATGGACACAGG + Intergenic
1024832724 7:53480335-53480357 CAATGAGAACACAGGGACACAGG - Intergenic
1024925616 7:54611073-54611095 TAATGAGAACACATGGACACAGG - Intergenic
1025616494 7:63122703-63122725 TAATGAGAACACATGGACACGGG + Intergenic
1026283912 7:68946435-68946457 CAATGAGAGCACATGGACACAGG + Intergenic
1026604082 7:71801007-71801029 TAATGAGAACACATGGACACAGG - Intronic
1027151158 7:75734630-75734652 TGATGCCAGCACAAGGTCACAGG + Intronic
1027335026 7:77141113-77141135 CAATGAGAACACAGGGACACAGG - Intronic
1027463995 7:78491773-78491795 TAATGTGAGGATAGGGGCACCGG + Intronic
1027477653 7:78653581-78653603 TAATGAGAACACATGGACACAGG + Intronic
1027490893 7:78825013-78825035 TAATGAGAACACATGGACACAGG + Intronic
1027976617 7:85165039-85165061 CAATGAGAACACAGGGACACAGG - Intronic
1028081625 7:86584573-86584595 CAATGACAACACATGGACACAGG - Intergenic
1028691167 7:93652629-93652651 CAATGAGAACACAGGGACACAGG - Intronic
1029864095 7:103606874-103606896 TAATGAGAACACATGGACACAGG - Intronic
1029947049 7:104543712-104543734 CAATGGGAGCACATGGACACAGG + Intronic
1030019653 7:105260830-105260852 TAATGAGAACACATGGACACAGG + Intronic
1030160055 7:106498283-106498305 CAATGACAACACATGGACACAGG + Intergenic
1030466382 7:109908425-109908447 TAATGAGATCACATGGACACAGG + Intergenic
1030495584 7:110295447-110295469 TAATAAGAACACAGGGACACAGG - Intergenic
1030578701 7:111323938-111323960 CAATGAGAACACAGGGACACAGG + Intronic
1030711457 7:112754685-112754707 CAATGAGAACACAGGGACACAGG - Intergenic
1030759907 7:113337624-113337646 TAATGAGAACACATGGACACGGG + Intergenic
1030760661 7:113346353-113346375 CAATGTGAACACATGGACACAGG - Intergenic
1030858104 7:114587271-114587293 GAATGAGAACACAGGGACACAGG - Intronic
1030962706 7:115947114-115947136 CAATGGGAGCACATGGACACAGG - Intronic
1031128597 7:117804717-117804739 CAATGTCAACACATAGACACAGG + Intronic
1031143292 7:117969497-117969519 TAATGAGAACACATGGACACAGG + Intergenic
1031211124 7:118827724-118827746 TAATGAGAACACATGGACACAGG + Intergenic
1031211320 7:118831088-118831110 TAATGAGAACACATGGACACAGG - Intergenic
1031710546 7:125040672-125040694 TAATGAGAACACATGGACACAGG + Intergenic
1033516115 7:142108252-142108274 TAAAGCCAGCACAGGAAGACAGG + Intergenic
1033614015 7:142993922-142993944 TAATGAGAACACATGGACACAGG + Intergenic
1033989707 7:147268458-147268480 TAATGAGAACACATGGACACAGG + Intronic
1034479559 7:151308983-151309005 TCCTCTCAGCACATGGACACGGG - Intergenic
1034847721 7:154462844-154462866 CAATGAGAGCACATGGACACAGG - Intronic
1035491268 7:159280927-159280949 AAATCTCAGCACAGGGAAATGGG - Intergenic
1035921080 8:3676950-3676972 CAATGACAACACAAGGACACAGG + Intronic
1035959269 8:4119038-4119060 TAATGAGAACACACGGACACAGG + Intronic
1035997776 8:4568318-4568340 CAATGAGAACACAGGGACACAGG - Intronic
1036417396 8:8563520-8563542 TAATGAGAACACATGGACACAGG + Intergenic
1036995117 8:13646232-13646254 CAATGAGAACACAGGGACACAGG + Intergenic
1037021999 8:13984806-13984828 CAATGAGAACACAGGGACACAGG - Intergenic
1037231118 8:16660118-16660140 CAATGAGAACACAGGGACACAGG + Intergenic
1037601672 8:20401399-20401421 TAATGAGAACACATGGACACAGG - Intergenic
1038845117 8:31222007-31222029 CAATGAGAACACAGGGACACAGG + Intergenic
1038895396 8:31776732-31776754 CAATGAGAGCACATGGACACAGG - Intronic
1038907021 8:31916398-31916420 CAATGAGAACACAGGGACACAGG - Intronic
1038932736 8:32213409-32213431 AAATGAGAGCACATGGACACAGG + Intronic
1039291430 8:36098172-36098194 CAATGTGAACACATGGACACAGG + Intergenic
1039658720 8:39438942-39438964 TAATGAGAACACATGGACACAGG + Intergenic
1040387533 8:46923680-46923702 TAAGTTCAGCACCTGGACACTGG + Intergenic
1040519555 8:48163577-48163599 TAATGAGAACACATGGACACAGG - Intergenic
1040587764 8:48759733-48759755 CAATGAGAGCACATGGACACAGG + Intergenic
1040621178 8:49094991-49095013 AAAAGTCAGCACAGAGACAAAGG - Intergenic
1040719182 8:50296559-50296581 AAATGAAAACACAGGGACACAGG + Intronic
1040734453 8:50488971-50488993 CAATGAGAACACAGGGACACAGG - Intronic
1040867619 8:52065737-52065759 CAATGACAACACATGGACACAGG - Intergenic
1040913732 8:52546860-52546882 AAAAGTCAGCACAGAGACAAAGG - Intronic
1040963365 8:53059312-53059334 CAATGAGAACACAGGGACACAGG + Intergenic
1041347806 8:56919589-56919611 CAATGAGAACACAGGGACACAGG + Intergenic
1041619809 8:59953741-59953763 TAATGAGAACACATGGACACAGG + Intergenic
1041681488 8:60597390-60597412 TAATGAGAACACATGGACACAGG + Intronic
1042322131 8:67487248-67487270 TAATGAGAGCACTTGGACACAGG - Intronic
1042820995 8:72929993-72930015 CAATGAGAACACAGGGACACAGG - Intronic
1042993049 8:74662382-74662404 TAATGAGAACACATGGACACAGG + Intronic
1042998916 8:74733275-74733297 TAATGAGAACACATGGACACAGG - Intronic
1043303712 8:78767964-78767986 CAATGAGAACACAGGGACACAGG - Intronic
1043724712 8:83595926-83595948 CAATGAGAACACAGGGACACAGG - Intergenic
1043756895 8:84015063-84015085 CAATGTGAACACACGGACACAGG - Intergenic
1044144276 8:88692098-88692120 TAATGAGAACACATGGACACAGG - Intergenic
1044156164 8:88849958-88849980 TAATGAGAACACATGGACACGGG + Intergenic
1044179240 8:89168012-89168034 CAATGAGAGCACATGGACACAGG + Intergenic
1044180858 8:89192351-89192373 CAATGAGAGCACATGGACACAGG + Intergenic
1044394388 8:91692853-91692875 TAATGAGAACACATGGACACAGG - Intergenic
1044944535 8:97378205-97378227 CAATGAGAACACAGGGACACAGG - Intergenic
1045394039 8:101742867-101742889 CAATGAGAACACAGGGACACAGG - Intronic
1045424555 8:102051665-102051687 AAATGTCAGCTCAGGAACATTGG - Intronic
1045639927 8:104238245-104238267 CAATGAGAACACAGGGACACAGG + Intronic
1045968122 8:108049597-108049619 TAATGAGAACACATGGACACAGG - Intronic
1046077468 8:109330834-109330856 TAATGAGATCACATGGACACAGG + Intronic
1046210589 8:111069300-111069322 CAATGAGAGCACATGGACACAGG - Intergenic
1046298877 8:112259387-112259409 CAATGAGAACACAGGGACACAGG + Intronic
1046624816 8:116565087-116565109 CAATGAGAGCACATGGACACAGG + Intergenic
1046929232 8:119826058-119826080 TAATGAGAACACATGGACACAGG + Intronic
1046983614 8:120363368-120363390 CAATGAGAACACAGGGACACAGG + Intronic
1047051912 8:121122160-121122182 TAATGTGAACACATGGACACAGG - Intergenic
1047215317 8:122871475-122871497 CAATGAGAGCACATGGACACAGG + Intronic
1047472358 8:125189142-125189164 AAAAGTCAGCACAGAGACAAAGG + Intronic
1047665828 8:127089971-127089993 CAATGACAACACATGGACACAGG - Intergenic
1047852115 8:128868288-128868310 TAATGAGAACACACGGACACAGG - Intergenic
1048373223 8:133798742-133798764 TAATGAGAACACATGGACACAGG + Intergenic
1048409174 8:134154012-134154034 CAATGAGAGCACATGGACACAGG - Intergenic
1048738759 8:137531442-137531464 TAATGAAAACACATGGACACAGG - Intergenic
1049136111 8:140901851-140901873 CAATGACAACACATGGACACAGG - Intronic
1049402533 8:142435969-142435991 TCATCTAAGCACAGGGGCACTGG + Intergenic
1049888120 9:41873-41895 CAATGAAAGCACATGGACACAGG - Intergenic
1050032286 9:1399289-1399311 GAATGTGAACACACGGACACAGG + Intergenic
1050123236 9:2330078-2330100 CAATGACAACACAGGGACACAGG - Intergenic
1050193291 9:3052854-3052876 GAATGACAACACATGGACACAGG + Intergenic
1050781224 9:9338886-9338908 TAATGAGAACACATGGACACAGG - Intronic
1051002610 9:12303329-12303351 CAATGAGAACACAGGGACACAGG - Intergenic
1051238312 9:15024905-15024927 CAATGACAACACACGGACACAGG - Intergenic
1051356969 9:16248201-16248223 TAAAATCAGCACAGAGACATTGG + Intronic
1051575246 9:18607771-18607793 CAATGAGAACACAGGGACACAGG - Intronic
1051614384 9:18993314-18993336 TAATGAGAACACATGGACACAGG - Intronic
1051703514 9:19851522-19851544 CAATGAGAACACAGGGACACAGG - Intergenic
1051926959 9:22339880-22339902 TAATGAGAACACATGGACACAGG + Intergenic
1051984601 9:23068634-23068656 TAATGAGAACACATGGACACAGG + Intergenic
1052222883 9:26048651-26048673 CAATGACAACACATGGACACAGG + Intergenic
1052249481 9:26380515-26380537 AAATGACAGCACAGGGAGACTGG - Intergenic
1052599728 9:30610185-30610207 CAATGACAACACATGGACACAGG + Intergenic
1055005220 9:71498352-71498374 CAATGAGAACACAGGGACACAGG + Intergenic
1055149324 9:72976521-72976543 TAATGAGAACACATGGACACAGG + Intronic
1055210848 9:73788973-73788995 TAATGAGAACACATGGACACAGG + Intergenic
1056343034 9:85656977-85656999 TAATGAGATCACATGGACACAGG + Intronic
1056837510 9:89968918-89968940 CAATGAGAACACAGGGACACAGG + Intergenic
1056971147 9:91204910-91204932 CAATGAGAACACAGGGACACAGG + Intergenic
1057080440 9:92170983-92171005 ACATTTCTGCACAGGGACACAGG - Intergenic
1057158159 9:92863213-92863235 CAATGTGAACACATGGACACAGG + Intronic
1057376707 9:94530987-94531009 TAATGAGAACACATGGACACAGG + Intergenic
1057615439 9:96585404-96585426 CAATGAGAACACAGGGACACAGG - Intronic
1057921338 9:99100547-99100569 CAATGAGAACACAGGGACACAGG + Intergenic
1058403627 9:104645527-104645549 TAATGAGAACACATGGACACAGG - Intergenic
1058687919 9:107493838-107493860 TAATGAGAACACATGGACACAGG - Intergenic
1058942470 9:109826161-109826183 CAATGAGAACACAGGGACACAGG + Intronic
1059932441 9:119274280-119274302 TAAGGCCAGCAAAGGGACGCTGG - Intronic
1060315860 9:122509943-122509965 TAATGAGAACACATGGACACAGG + Intergenic
1060611183 9:124966271-124966293 CAATGAGAGCACATGGACACAGG - Intronic
1061874863 9:133538617-133538639 ACATGTGAGCACAGGGACAGTGG - Intronic
1062319968 9:135986075-135986097 TGATGCCTGCGCAGGGACACAGG - Intergenic
1062742346 9:138184119-138184141 CAATGACATCACATGGACACAGG - Intergenic
1203532237 Un_GL000213v1:156848-156870 CAATGAGAACACAGGGACACAGG - Intergenic
1185511838 X:669679-669701 CAATGACAACACATGGACACAGG + Intergenic
1185692074 X:2163569-2163591 CAATGAGAACACAGGGACACAGG - Intergenic
1185711313 X:2305787-2305809 CAATGAGAACACAGGGACACAGG + Intronic
1185749953 X:2603015-2603037 GAATGAGAGCACATGGACACGGG + Intergenic
1186235899 X:7509218-7509240 CAATGACAACACATGGACACAGG - Intergenic
1186755915 X:12671532-12671554 TAATGAGAACACATGGACACAGG + Intronic
1186903487 X:14085327-14085349 CAATGAGAGCACATGGACACAGG - Intergenic
1187575913 X:20555188-20555210 TAATGAGAACACATGGACACAGG + Intergenic
1187603525 X:20859156-20859178 TAATGAGAACACATGGACACAGG - Intergenic
1188256122 X:27963742-27963764 CAATGAGAGCACATGGACACAGG - Intergenic
1188415828 X:29933131-29933153 CAATGAGAACACAGGGACACAGG + Intronic
1188633681 X:32401128-32401150 CAATGAGAGCACATGGACACAGG + Intronic
1188848287 X:35101049-35101071 TAATGGGAACACATGGACACAGG - Intergenic
1189290072 X:39878521-39878543 CAATTTCATCACAGGGAGACAGG + Intergenic
1189436041 X:40993465-40993487 CAATGAGAACACAGGGACACAGG - Intergenic
1189979281 X:46492937-46492959 CAATGAGAACACAGGGACACAGG + Intronic
1190543198 X:51498747-51498769 TAATGAGAACACATGGACACAGG + Intergenic
1190601833 X:52100766-52100788 CAATGTGAACACATGGACACAGG - Intergenic
1190606186 X:52145521-52145543 TAATGAGAACACATGGACACAGG - Intergenic
1190926277 X:54908314-54908336 TAATGAGAACACATGGACACAGG + Intergenic
1190945152 X:55085546-55085568 CAATGACAACACATGGACACAGG + Intergenic
1191045988 X:56137552-56137574 CAATGAGAACACAGGGACACAGG + Intergenic
1191046752 X:56146509-56146531 CAATGAGAGCACATGGACACAGG + Intergenic
1191069812 X:56388675-56388697 TAATGAGAACACATGGACACTGG - Intergenic
1191074860 X:56441935-56441957 CAATGAGAGCACATGGACACAGG + Intergenic
1191083651 X:56540370-56540392 TAATGAGAACACAGGGACACAGG + Intergenic
1191160161 X:57321271-57321293 TAATGAGAACACATGGACACAGG + Intronic
1191198413 X:57750051-57750073 CAATGAGAGCACAGGGACACAGG + Intergenic
1191266647 X:58401572-58401594 TAATGAGAACACATGGACACAGG + Intergenic
1191271499 X:58478001-58478023 CAATGAGAGCACATGGACACAGG - Intergenic
1191749281 X:64523914-64523936 CAATGTAAACACATGGACACAGG + Intergenic
1191756481 X:64598170-64598192 TAATGAGAACACATGGACACAGG + Intergenic
1191824687 X:65352263-65352285 CAATGAGAGCACATGGACACAGG + Intergenic
1191933491 X:66400515-66400537 CAATGAGAGCACATGGACACAGG - Intergenic
1191942415 X:66495487-66495509 CAATGAAAGCACATGGACACAGG + Intergenic
1191983457 X:66952301-66952323 CAATGAGAGCACATGGACACAGG - Intergenic
1192898194 X:75466840-75466862 CAATGTGAACACATGGACACAGG + Intronic
1192906061 X:75551921-75551943 TAATTTTAACACATGGACACAGG + Intergenic
1192946881 X:75973281-75973303 TAATGAGATCACATGGACACAGG + Intergenic
1192976066 X:76287436-76287458 TAATGAGAACACATGGACACAGG - Intergenic
1193003189 X:76585744-76585766 CAATGACAACACATGGACACAGG - Intergenic
1193222090 X:78937505-78937527 CAATGAGAACACAGGGACACAGG - Intergenic
1193326728 X:80186700-80186722 TAATGAGAACACATGGACACAGG - Intergenic
1193327465 X:80196407-80196429 TAATGAGAACACATGGACACAGG + Intergenic
1193393094 X:80952561-80952583 TAATGAGAACACATGGACACAGG + Intergenic
1193495187 X:82202383-82202405 TAATGAGAACACATGGACACAGG + Intergenic
1193504756 X:82328652-82328674 TAATGAGAACACATGGACACAGG + Intergenic
1193507058 X:82357736-82357758 CAATGAGAGCACATGGACACAGG + Intergenic
1193521540 X:82535930-82535952 TAATGAGAACACATGGACACAGG - Intergenic
1193781215 X:85703523-85703545 TAATGAGAACACATGGACACAGG + Intergenic
1193801567 X:85942954-85942976 CAATGAGAACACAGGGACACAGG - Intronic
1193927144 X:87501360-87501382 CAATGAGATCACAGGGACACAGG + Intergenic
1194054478 X:89114878-89114900 CAATGAGAGCACATGGACACAGG + Intergenic
1194069624 X:89305126-89305148 TAATGAGAACACATGGACACAGG - Intergenic
1194159096 X:90428675-90428697 CAATGTGAACACATGGACACAGG + Intergenic
1194175967 X:90648939-90648961 TAATGAGAACACATGGACACAGG - Intergenic
1194448028 X:94010527-94010549 TCTCGTGAGCACAGGGACACTGG - Intergenic
1194556856 X:95370119-95370141 CAATGACAACACATGGACACAGG - Intergenic
1194601493 X:95926567-95926589 CAATGAGAGCACATGGACACAGG + Intergenic
1194832462 X:98640952-98640974 CAATGAGAACACAGGGACACAGG + Intergenic
1195110595 X:101645170-101645192 TATTGAGAACACAGGGACACGGG + Intergenic
1195117182 X:101711269-101711291 CAATGAGATCACAGGGACACAGG - Intergenic
1195148328 X:102041137-102041159 TAATGAGAGCACATGGACACAGG + Intergenic
1195432986 X:104810211-104810233 CAATGAGAGCACATGGACACAGG + Intronic
1195433505 X:104815868-104815890 TGATGTCAGCAGAGGAACAAAGG - Intronic
1195518605 X:105805679-105805701 CAATGAGAACACAGGGACACAGG - Intergenic
1195866312 X:109436732-109436754 CAATGAGAGCACATGGACACAGG + Intronic
1195875793 X:109539066-109539088 TAATGAGAACACATGGACACAGG - Intronic
1195983331 X:110602793-110602815 CAATGAGAGCACATGGACACAGG - Intergenic
1196964562 X:121041901-121041923 CAATGTTAACACATGGACACAGG + Intergenic
1197018705 X:121659658-121659680 CAATGAGAGCACATGGACACAGG - Intergenic
1197033081 X:121842323-121842345 CAATGACAACACATGGACACAGG + Intergenic
1197048384 X:122028193-122028215 CAATGAGAGCACATGGACACAGG - Intergenic
1197060242 X:122170626-122170648 CAATGAGAGCACATGGACACAGG - Intergenic
1197395939 X:125927561-125927583 TAATGAGAACACATGGACACAGG - Intergenic
1197506526 X:127311680-127311702 TAATGAGAGCACATGGACACAGG + Intergenic
1197544518 X:127808577-127808599 TACCGTCACCACAGGCACACAGG - Intergenic
1197576340 X:128216891-128216913 TAATGAGAACACATGGACACAGG + Intergenic
1197668258 X:129246789-129246811 TAATGAGAACACATGGACACAGG + Intergenic
1197671831 X:129285688-129285710 TAATGAGAACACATGGACACAGG + Intergenic
1197814103 X:130478860-130478882 CAATGAGAGCACATGGACACAGG + Intergenic
1198273011 X:135073141-135073163 TAATGAGAACACATGGACACAGG - Intergenic
1198610438 X:138393876-138393898 CAATGAAAGCACATGGACACAGG + Intergenic
1198788925 X:140320905-140320927 TAATGAGAACACATGGACACAGG - Intergenic
1198992061 X:142525904-142525926 CAATGACAACACATGGACACAGG - Intergenic
1199012059 X:142769840-142769862 CAATGAGAACACAGGGACACAGG - Intergenic
1199135258 X:144242851-144242873 TAATGACAACACATGGACACAGG - Intergenic
1199190811 X:144967722-144967744 CAATGACAACACATGGACACAGG + Intergenic
1199330780 X:146555870-146555892 TAATGAGAACACATGGACACAGG + Intergenic
1199455604 X:148024593-148024615 TGATGTCAGCACAGGGAAGTGGG + Intronic
1199901839 X:152181618-152181640 CAATGACAACACATGGACACAGG + Intronic
1200416575 Y:2917989-2918011 CAATGACAACACATGGACACAGG - Intronic
1200505413 Y:4005643-4005665 CAATGTGAACACATGGACACAGG + Intergenic
1200522601 Y:4229880-4229902 TAATGAGAACACATGGACACAGG - Intergenic
1200723772 Y:6639268-6639290 TAATGAGAACACATGGACACAGG - Intergenic
1200819730 Y:7570248-7570270 CAATGAGAACACAGGGACACAGG - Intergenic
1200862673 Y:8009498-8009520 TAATGAAAGCCCAGGCACACAGG - Intergenic
1200867034 Y:8055687-8055709 CAATGAGAACACAGGGACACAGG - Intergenic
1201245344 Y:11997777-11997799 TAATGAGAACACATGGACACCGG - Intergenic
1201666748 Y:16466172-16466194 CAATGTGAACACATGGACACAGG + Intergenic
1201677116 Y:16598316-16598338 CAATGAGAACACAGGGACACAGG - Intergenic
1201936170 Y:19412854-19412876 CAATGAGAGCACATGGACACAGG - Intergenic
1202241770 Y:22778174-22778196 CAATGTGAACACATGGACACAGG - Intergenic
1202258738 Y:22947338-22947360 CAATGAGAGCACATGGACACAGG + Intergenic
1202394752 Y:24411918-24411940 CAATGTGAACACATGGACACAGG - Intergenic
1202459055 Y:25088976-25088998 CAATGAGAGCACATGGACACAGG - Intergenic
1202476032 Y:25258174-25258196 CAATGTGAACACATGGACACAGG + Intergenic