ID: 935816431

View in Genome Browser
Species Human (GRCh38)
Location 2:106850284-106850306
Sequence GAGAGAGCAAACTCTGCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 151}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935816431_935816432 -8 Left 935816431 2:106850284-106850306 CCTGTGGCAGAGTTTGCTCTCTC 0: 1
1: 0
2: 2
3: 24
4: 151
Right 935816432 2:106850299-106850321 GCTCTCTCTGCCCGCTGTGCTGG 0: 1
1: 0
2: 1
3: 14
4: 230
935816431_935816436 6 Left 935816431 2:106850284-106850306 CCTGTGGCAGAGTTTGCTCTCTC 0: 1
1: 0
2: 2
3: 24
4: 151
Right 935816436 2:106850313-106850335 CTGTGCTGGGAAGTAGAAAGAGG 0: 1
1: 1
2: 1
3: 40
4: 387
935816431_935816438 20 Left 935816431 2:106850284-106850306 CCTGTGGCAGAGTTTGCTCTCTC 0: 1
1: 0
2: 2
3: 24
4: 151
Right 935816438 2:106850327-106850349 AGAAAGAGGCAGGATTTGTGAGG 0: 1
1: 0
2: 1
3: 41
4: 463
935816431_935816433 -7 Left 935816431 2:106850284-106850306 CCTGTGGCAGAGTTTGCTCTCTC 0: 1
1: 0
2: 2
3: 24
4: 151
Right 935816433 2:106850300-106850322 CTCTCTCTGCCCGCTGTGCTGGG 0: 1
1: 0
2: 3
3: 31
4: 282
935816431_935816437 10 Left 935816431 2:106850284-106850306 CCTGTGGCAGAGTTTGCTCTCTC 0: 1
1: 0
2: 2
3: 24
4: 151
Right 935816437 2:106850317-106850339 GCTGGGAAGTAGAAAGAGGCAGG 0: 1
1: 0
2: 3
3: 62
4: 561

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935816431 Original CRISPR GAGAGAGCAAACTCTGCCAC AGG (reversed) Intronic
900087818 1:906860-906882 GCGACAGCAGACTCTGGCACTGG - Intergenic
900330672 1:2133035-2133057 GGGTGAACAAACTCTCCCACAGG - Intronic
901143697 1:7051735-7051757 GAGGGAGCAGCCTCTGTCACAGG - Intronic
901952568 1:12760524-12760546 GGGAGATCAGGCTCTGCCACGGG - Intronic
903781378 1:25822136-25822158 GAGACAGGAAAAGCTGCCACTGG - Intronic
905563019 1:38941978-38942000 GAAAGAGCAGAGGCTGCCACCGG - Intergenic
907038167 1:51235207-51235229 GAGAGAGCATACTCTACCTTGGG + Intergenic
908116976 1:60950171-60950193 GAGAGAGCCAACGCTCCCACTGG - Intronic
909802064 1:79822238-79822260 GAGAGAACAAACGCTGGAACTGG + Intergenic
910830676 1:91458231-91458253 GAGAGAGTAGACTCTGCCTAGGG - Intergenic
913696510 1:121331387-121331409 GAGAGAGGATGCTATGCCACTGG + Intronic
914141051 1:144948674-144948696 GAGAGAGGATGCTATGCCACTGG - Intronic
914219172 1:145662699-145662721 AGGTGAGCAAACTCTGCCACTGG - Intronic
914372534 1:147041497-147041519 GAGAGACCAAACTCTGCAGGTGG - Intergenic
914471755 1:147985570-147985592 AGGTGAGCAAACTCTGCCACTGG - Intronic
915298805 1:154940490-154940512 GAGGGGGCAAATTCTGCCACTGG - Intergenic
916015548 1:160746736-160746758 GAGACAGCAAAGACTGGCACTGG + Intronic
920483837 1:206349740-206349762 GAGAGAGGATGCTATGCCACTGG + Intronic
923509879 1:234641562-234641584 GAGTAAGCAATCTCTGCCAGGGG - Intergenic
923715890 1:236424626-236424648 ATGAGAGCAACCACTGCCACAGG - Intronic
1065078340 10:22103022-22103044 GAGAGGGGAAGCTTTGCCACGGG + Intergenic
1066996960 10:42572789-42572811 GGAAGAGAATACTCTGCCACTGG + Intergenic
1067701986 10:48580420-48580442 GACAGAGCCTCCTCTGCCACAGG - Intronic
1068863931 10:61874981-61875003 CAGCCAGCAATCTCTGCCACAGG - Intergenic
1069209735 10:65741344-65741366 CAGAAAGCAAACTTTGCCAGTGG + Intergenic
1069665295 10:70151381-70151403 GAGAGACCAAATTCTGCAAATGG + Exonic
1072189331 10:93067358-93067380 GAGAGAGCAGACTCAGACAAAGG + Intronic
1072663644 10:97379068-97379090 CACAGGGCAAGCTCTGCCACAGG + Intronic
1073028884 10:100508895-100508917 GAGATATCAAACTTTACCACTGG - Intronic
1073512449 10:104051312-104051334 GGGAGCCCAACCTCTGCCACAGG + Intronic
1074555203 10:114483076-114483098 GTGTGTGGAAACTCTGCCACTGG + Intronic
1075522475 10:123151213-123151235 GAGACACATAACTCTGCCACCGG - Intergenic
1076780754 10:132723271-132723293 GAGAGAGGAAACTCGGTCAGTGG + Intronic
1077071877 11:678348-678370 GAGAGACCAAGACCTGCCACTGG + Intronic
1078165831 11:8884107-8884129 GAGAGAGCAACTTCTGACACAGG - Intronic
1078388000 11:10909724-10909746 GTGAGAACACACTCTGCCTCAGG + Intergenic
1079188129 11:18255192-18255214 AAGAGAGTGAACTATGCCACAGG - Intergenic
1083291275 11:61691598-61691620 GAGGGAACAAACACAGCCACAGG + Intronic
1084170289 11:67397612-67397634 GAGAGACCCAGTTCTGCCACTGG - Exonic
1084360214 11:68664364-68664386 GAGAGAGGAAATACAGCCACAGG - Intergenic
1084486987 11:69454272-69454294 GCGAGAGCCACCTCTGCCCCAGG + Intergenic
1086220389 11:84436405-84436427 GAGAGAAAACACTGTGCCACAGG + Intronic
1086258384 11:84907746-84907768 GAGAATGCAAACTCTGTCATTGG - Intronic
1088116072 11:106316396-106316418 CAGAGTGCAATCTCTGCCAAAGG - Intergenic
1089688518 11:120171782-120171804 GAGAGAGCAGAATCTCCCACAGG - Intronic
1090768315 11:129895873-129895895 CAGAGAGCATACCCTGCCCCAGG + Intergenic
1091850879 12:3695917-3695939 GAGTGGGCAAACTCTGCCCCTGG + Intronic
1093853233 12:24066907-24066929 GAGAGAACTAACTCTACCAGTGG + Intergenic
1096243984 12:49974251-49974273 GACAGAGAAACCCCTGCCACTGG - Intronic
1097278850 12:57831959-57831981 GAAAGATCAAACTATTCCACAGG + Intronic
1099384566 12:81998764-81998786 TAGAGAGCATTCTTTGCCACTGG - Intergenic
1100522403 12:95387944-95387966 GAGAAAGCCCACTCTGACACAGG - Intergenic
1107556024 13:41517400-41517422 GAGAGAGCAGACTCTGCATCTGG + Intergenic
1110333792 13:74302805-74302827 GAGAGGGGAAATTCTGCCAAAGG + Intergenic
1111250269 13:85592379-85592401 GAGATAGACAACTCTGCCCCAGG - Intergenic
1111568803 13:90051237-90051259 AAGAGAGCAAGATCTGCCAATGG + Intergenic
1112895054 13:104288644-104288666 GAGAGAGCACAGTCTGCCGCCGG + Intergenic
1119786491 14:77318264-77318286 GAGATGACAAACTCAGCCACAGG - Intronic
1119902142 14:78270268-78270290 GAGAGAGAAAAGTGTGTCACAGG - Intronic
1121693555 14:95894706-95894728 GGAAGAGCAAGCTCTCCCACAGG + Intergenic
1122415238 14:101546487-101546509 CAGCCAGCAATCTCTGCCACTGG + Intergenic
1122719484 14:103714310-103714332 GAGAGGGCAGAGTCAGCCACAGG + Intronic
1127700826 15:61498816-61498838 GAGAGAGAAATCATTGCCACAGG + Intergenic
1127924974 15:63530342-63530364 GACAGAGCAAACTGTGCCTCAGG - Intronic
1128870337 15:71150406-71150428 GCCAGAGGAAACTCTGCCAAGGG - Intronic
1129317994 15:74757652-74757674 GAGACTGCAAACTCTGTCCCTGG - Intergenic
1131485096 15:92813575-92813597 AAGAGATCAACCTCTGCCATAGG - Intergenic
1132407394 15:101552139-101552161 GCGGGAGCAATCTCTGCCATGGG + Intergenic
1132812985 16:1810589-1810611 GAGAATGCAAACCCAGCCACGGG + Intronic
1133653470 16:7835467-7835489 GAGATAGCCAACTCTGTTACCGG - Intergenic
1137487281 16:48902141-48902163 CAGGGAGGCAACTCTGCCACCGG + Intergenic
1138269532 16:55685197-55685219 GACAGAGCAAGAGCTGCCACTGG - Exonic
1140863984 16:79043840-79043862 TAGAGAGCAAACTCTGGAAGTGG + Intronic
1141253416 16:82379602-82379624 GAGAAGGCAGCCTCTGCCACAGG + Intergenic
1142323447 16:89399954-89399976 GAGAGGGCAGCCTCTGCCCCAGG + Intronic
1144322442 17:14142326-14142348 GAGACAGAAAACTGTGACACAGG + Intronic
1146441066 17:32895511-32895533 GAGTGGGCCAACTCAGCCACTGG + Intergenic
1146595624 17:34165952-34165974 GGGAGAGGAAACTCTGCTAGAGG + Intronic
1147121110 17:38335562-38335584 ATGAGAGCAAAGTCTGCCCCAGG + Intronic
1147975828 17:44247672-44247694 CAGAGAGCTAACTCTGCCAGGGG - Intergenic
1148364861 17:47047063-47047085 GAGGCAGCCAACGCTGCCACAGG - Intronic
1152688538 17:81707095-81707117 GAGAGAGCAAAGTCAGGGACTGG - Intronic
1155196967 18:23484862-23484884 GAGGGAAAAAAATCTGCCACAGG + Intronic
1157976617 18:52335022-52335044 TAGAGAGGAGACTCTTCCACAGG + Intergenic
1158004210 18:52653584-52653606 GAGAGTTCAAACTTTGCCAGAGG + Intronic
1158594822 18:58806975-58806997 GAGAGAGCAAACTCGTCCCCTGG + Intergenic
1159277075 18:66234858-66234880 GACAGAGTAAACTGTGACACAGG - Intergenic
1159947453 18:74454940-74454962 GGGGGAGCAGACTTTGCCACAGG - Intronic
1161550196 19:4908644-4908666 GAGAGAGGATACTCTCTCACTGG - Intronic
1161572812 19:5039761-5039783 CAGAGAGCAGACTGTGCCACCGG - Intronic
1161827423 19:6577752-6577774 GAGAAGGCAAACACTTCCACTGG - Intergenic
1164487683 19:28674412-28674434 GGGTCAGCAAACTCTGGCACAGG + Intergenic
1164683458 19:30151216-30151238 CAGAGAGCAACCTCTGCTTCAGG - Intergenic
1167634280 19:50645094-50645116 GAGAGAGCAAACACTGAGAATGG + Intronic
1167694097 19:51003776-51003798 TGGAGAACAAACTCTGTCACTGG - Exonic
1168408667 19:56124573-56124595 AAGAGAGAAAATTCTGACACAGG + Intergenic
925699286 2:6617359-6617381 GAGAGAGCAAACCCTTTCATGGG + Intergenic
926006802 2:9378900-9378922 GAGAGAGCATAGTGTGTCACAGG - Intronic
927380078 2:22469170-22469192 GAGATAGGCAACTCTGCCTCCGG - Intergenic
927679448 2:25130263-25130285 GTGACAGCAAAAGCTGCCACAGG + Intronic
929512857 2:42579443-42579465 GACAGAGCAAACTTTGTCTCCGG - Intronic
930471869 2:51826563-51826585 GACAGAGCAAAATTTGTCACAGG + Intergenic
934515992 2:94987179-94987201 GAGATAACAAACTCTACTACTGG + Intergenic
935816431 2:106850284-106850306 GAGAGAGCAAACTCTGCCACAGG - Intronic
937044906 2:118846208-118846230 GGGAGAGCAAACCCGGCCTCGGG - Intronic
938295769 2:130178454-130178476 GGAAGAGCAAGCTCTGCCAAGGG + Intronic
938460849 2:131495365-131495387 GGAAGAGCAAGCTCTGCCAAGGG - Intergenic
939041195 2:137191092-137191114 CAGACAGCAGACTCTGCCAGAGG - Intronic
941967616 2:171315026-171315048 GAGGAAGCACACTCTGTCACTGG - Intergenic
944963712 2:204905386-204905408 GAGACAGCACACTATACCACTGG - Intronic
945431644 2:209771948-209771970 GAGAGAGCCGGCTCTGCCTCGGG + Intergenic
946292796 2:218758036-218758058 GAGCGGGCAAACTCTGCTACAGG - Intergenic
946817099 2:223590458-223590480 GAGAGAGAAAAGTCTGCAAGAGG + Intergenic
1169942521 20:10952507-10952529 GAGAGAGAAAATTCTTCCTCTGG + Intergenic
1170148952 20:13207644-13207666 GAGAGAGCAAATTCTTCCTTCGG + Intergenic
1174551142 20:51362563-51362585 CAAATAGCAATCTCTGCCACAGG + Intergenic
1175478341 20:59293016-59293038 GAGAGAGCAAAATCTCCTGCCGG - Intergenic
1175496516 20:59418267-59418289 CAGAGAGCAAACCCTGCCTTGGG + Intergenic
1178817698 21:35946614-35946636 GAGAGTCCCCACTCTGCCACTGG + Intronic
1178957681 21:37038431-37038453 GATGGAGCAAACACTGTCACAGG + Intergenic
1180600172 22:17010244-17010266 GAGAGTGCAGAGACTGCCACAGG + Intergenic
950954833 3:17041262-17041284 CAAAGTGCAAACTCTGCCATAGG + Intronic
957603159 3:82365052-82365074 GAGGGATCAAACCCTACCACAGG + Intergenic
968035426 3:195543943-195543965 GAGGGAACCAACTCTGCCGCAGG + Intergenic
971883255 4:32409725-32409747 GATAGAGCAAACAAAGCCACAGG + Intergenic
972594347 4:40516827-40516849 CTGAGAGGAAACTATGCCACAGG - Intronic
974462557 4:62206553-62206575 AAGAGAGAAAACTCTGGCCCTGG + Intergenic
983544039 4:168943467-168943489 GAGAAAGCTAACTCAGCCATTGG + Intronic
994404060 5:99320710-99320732 GAGAGAGCAAAATCTGGAACTGG - Intergenic
995723513 5:115162384-115162406 GAATGAGAAACCTCTGCCACAGG - Intronic
996599627 5:125246470-125246492 AAGAGAGAAAACTCTGCAATAGG - Intergenic
997441723 5:133913286-133913308 GAGAGAGGGAACTCTGCAGCAGG + Intergenic
999255197 5:150206097-150206119 GAGAGAGTGCACTCTGCCACAGG + Intronic
1002873298 6:1187420-1187442 GAGAGGTCAAAGTCAGCCACGGG - Intergenic
1004070849 6:12296112-12296134 GAGAGTGCAGAGTCGGCCACAGG - Exonic
1005696621 6:28357751-28357773 GAGAGAGCATAGGCTGCCCCTGG - Intronic
1007680670 6:43631139-43631161 GAGAGACCAAAATCTGCAAAAGG + Intronic
1008851383 6:56026770-56026792 GAGAGAGAAAACTGTACCAGAGG + Intergenic
1009529969 6:64800361-64800383 CAGAGATCAAATTCTGACACTGG + Intronic
1010716375 6:79234381-79234403 GAGAGAGGAACGTCTGCAACAGG + Intronic
1013191410 6:107806919-107806941 GAGGGAGCCAACTCTGCCAGCGG - Intronic
1017029811 6:150211105-150211127 GAGAGAGAAAACTCCGCCAGGGG - Intronic
1017072658 6:150589576-150589598 GACAGAGCAGACTCTGTCTCAGG - Intergenic
1017606686 6:156142337-156142359 GAGAGGTGAAACTGTGCCACAGG - Intergenic
1017984181 6:159428074-159428096 GAGAGAGCAAGCTCTGGCAAGGG - Intergenic
1018510890 6:164523540-164523562 GAAAGATGAAAATCTGCCACTGG + Intergenic
1018883036 6:167904225-167904247 GAGAGAGCAGACTCTGTCTCAGG - Intronic
1019796817 7:3055826-3055848 CAGAGAGCAATCTCAGCCAGTGG + Intergenic
1021240505 7:18195043-18195065 AATAAAACAAACTCTGCCACTGG + Intronic
1021973347 7:25986219-25986241 GAGGGAGCACACACAGCCACAGG + Intergenic
1022298923 7:29084182-29084204 TAAAGTCCAAACTCTGCCACAGG + Intronic
1030020419 7:105270194-105270216 GAGAGAGCAGAATCTACCACAGG + Intronic
1030389186 7:108904503-108904525 GAGAAAACCAACTCTGCCACTGG + Intergenic
1033195171 7:139321474-139321496 GAGAGTGCAAACCATGCCAAAGG - Intergenic
1036540161 8:9699757-9699779 GAGAGAGCAAACTCTATGGCAGG - Intronic
1036564917 8:9930414-9930436 GAGGGAGCAGGTTCTGCCACAGG + Intergenic
1037277927 8:17201453-17201475 GAGAGAGAAAAGGCTGCCCCTGG - Intronic
1044041608 8:87376334-87376356 TAGAGAGCAAGCTCTGACAAGGG + Intronic
1045113228 8:98953067-98953089 GTGAGAGCCTACTGTGCCACAGG - Intergenic
1047076798 8:121413176-121413198 GAGACAGCCACGTCTGCCACTGG + Intergenic
1047341466 8:123984564-123984586 TAGAGAGTAAACTCAGCCTCAGG + Intronic
1048430437 8:134365427-134365449 GAGTTAGCCATCTCTGCCACAGG - Intergenic
1049173808 8:141179088-141179110 AAGAGAGCAAACTGTGCCCAAGG - Intronic
1049814827 8:144593613-144593635 GAGAGTGAAAACACAGCCACAGG + Intronic
1051610696 9:18958953-18958975 GAGTAAGAAAACTCTGTCACAGG + Intronic
1052473521 9:28929718-28929740 GAGAGTGCAAACTGCGCCAATGG + Intergenic
1055444313 9:76367618-76367640 GAGAATGCAAACTCGGGCACTGG - Intergenic
1056236897 9:84603721-84603743 GAGAGAGCAAACTCTCCTGCTGG + Intergenic
1059402775 9:114081070-114081092 GAGAGAGTAAATGCTGCCAAGGG + Intergenic
1059499389 9:114738094-114738116 TAAAGACCAATCTCTGCCACAGG - Intergenic
1059579311 9:115526729-115526751 GAAACAGCAAACTCTGCCTCAGG - Intergenic
1186351349 X:8742782-8742804 GAGAGAGCAACATCCACCACTGG - Intergenic
1189444857 X:41071080-41071102 GAGCTAGCCATCTCTGCCACGGG + Intergenic
1189561540 X:42195996-42196018 GAGGGTCCAACCTCTGCCACGGG - Intergenic
1191871443 X:65749177-65749199 GTGAGACTAAATTCTGCCACTGG - Intergenic
1197845915 X:130802626-130802648 GGGAGACCAAACTCTGCCACTGG - Intronic
1198169507 X:134091861-134091883 GAGAGAGCAAACCATGCCACAGG + Intergenic
1201576535 Y:15467151-15467173 GAGAGAGGAACCTATGCCAAAGG - Intergenic