ID: 935816670

View in Genome Browser
Species Human (GRCh38)
Location 2:106852490-106852512
Sequence CCTGTAAGGTTCCCGAAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 78}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935816665_935816670 -9 Left 935816665 2:106852476-106852498 CCACAATGGGGATGCCTGTAAGG 0: 1
1: 0
2: 0
3: 4
4: 82
Right 935816670 2:106852490-106852512 CCTGTAAGGTTCCCGAAGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 78
935816660_935816670 24 Left 935816660 2:106852443-106852465 CCGGATAATGTAAAATTCAGATG 0: 1
1: 0
2: 4
3: 17
4: 282
Right 935816670 2:106852490-106852512 CCTGTAAGGTTCCCGAAGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 78
935816664_935816670 -8 Left 935816664 2:106852475-106852497 CCCACAATGGGGATGCCTGTAAG 0: 1
1: 0
2: 0
3: 8
4: 85
Right 935816670 2:106852490-106852512 CCTGTAAGGTTCCCGAAGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935816670 Original CRISPR CCTGTAAGGTTCCCGAAGGT GGG Intronic
900159720 1:1217804-1217826 TCTGGAAGGTTCCCGAAGGGAGG + Intronic
901236482 1:7670060-7670082 CCTGGGAGGTTCCTGAGGGTGGG + Intronic
902525254 1:17053390-17053412 CCTCGAAGGATCCCGGAGGTGGG - Intronic
903491124 1:23729340-23729362 CAGGGAAGGTTCCAGAAGGTGGG + Intergenic
903521640 1:23955166-23955188 CCTTTAAGGGTCTTGAAGGTTGG + Intergenic
905442418 1:38004035-38004057 CCTGTCAGCTTCTAGAAGGTGGG - Intronic
909586135 1:77290851-77290873 ACTGTAAGGTCCCCAAAGGAAGG - Intronic
919983218 1:202655548-202655570 CCTGCAAGGGTCACGTAGGTTGG - Intronic
920036007 1:203065982-203066004 CCTGTAATGTTCCCAAGGGCTGG + Intronic
1062972604 10:1660395-1660417 TCTGTAAACTTCCCAAAGGTGGG - Intronic
1073124258 10:101140027-101140049 CCTGTGATGTTCCTGAAGATGGG - Intergenic
1075724437 10:124604272-124604294 CCTGGCAGGTGCCCGAGGGTCGG - Intronic
1083751786 11:64765030-64765052 CTTGTAAAGTTGCCGAGGGTAGG - Exonic
1084004068 11:66314044-66314066 CCTGTAAGCTTCGCGGAAGTTGG - Intergenic
1089895334 11:121925042-121925064 CCTGTAAGCTTTGGGAAGGTGGG - Intergenic
1091549641 12:1528236-1528258 ACTGTAAACTTCCTGAAGGTGGG + Intergenic
1091628665 12:2141656-2141678 GCTGCGAGGTTCCAGAAGGTTGG + Intronic
1099885610 12:88526567-88526589 CCTGTAAACTTCACAAAGGTAGG - Intronic
1100667030 12:96766368-96766390 TCTTTAAGGTTCCCATAGGTGGG + Intronic
1106719827 13:32426793-32426815 TCTGTAAGTTTCTTGAAGGTAGG - Intronic
1108225593 13:48285766-48285788 CTTGTAAGGTTCATGAAGGCAGG + Intergenic
1114875659 14:26714854-26714876 AATGTAAGGTTCTCGAAGGCAGG + Intergenic
1115714748 14:36090770-36090792 CCTGTAAGCTCCCAGAAGGCAGG - Intergenic
1116106190 14:40510620-40510642 CTTGTAAAGTTCCAGAAGATGGG - Intergenic
1119173498 14:72552378-72552400 CCTGTAAGGTGCTGGGAGGTGGG + Intronic
1130125763 15:81093001-81093023 CCTGGAAGGTTCACACAGGTTGG + Intronic
1133442519 16:5832629-5832651 CCTGTAAGTTCCCTGAAGGCAGG + Intergenic
1134001783 16:10788520-10788542 CCCGTAAGGTACCCGAAGTCCGG + Intronic
1134034485 16:11019141-11019163 CCTGTATGTCTCCCGAAGGTGGG + Intronic
1134380448 16:13719469-13719491 ACTGTAAGTTTACCGAAGATAGG - Intergenic
1137365394 16:47855543-47855565 CCAGTAAGGTACACGAAGGGAGG - Intergenic
1137553641 16:49456643-49456665 CCTGTCAGGTTCCCAAAGTTGGG - Intergenic
1143102486 17:4512160-4512182 CCTGTAAGGCCCCCAAAGGCAGG + Intronic
1147908613 17:43840711-43840733 TCTTTAAGGTACCCGAGGGTAGG + Intergenic
1148191260 17:45680322-45680344 CCTGTAGGGTGCCCCAGGGTAGG + Intergenic
1149646041 17:58242400-58242422 CCTGCCAGGTTTCCGAAGGGAGG + Intronic
1150638233 17:66931629-66931651 ACTGTAAGTTTCCTGAAGGTAGG - Intergenic
1150695296 17:67399816-67399838 CCTGTAAGTTGCCCGGAGTTGGG + Intronic
1152920924 17:83066255-83066277 CCAGGAAACTTCCCGAAGGTCGG - Intergenic
1156369158 18:36457045-36457067 CCAGTCAGGTTCCAGCAGGTGGG + Intronic
1158284260 18:55861824-55861846 CCTGTCAAGTTCCCAAAGGAGGG + Intergenic
1160881788 19:1324300-1324322 CCTGTAGGCTCCCCGAGGGTAGG - Intergenic
1165431666 19:35776442-35776464 CCCATAAGGTTCCCCAAGGCAGG - Intronic
1167292891 19:48634464-48634486 GCTCTAAGGTTCCAGAAGATTGG + Intronic
929316436 2:40484632-40484654 CGTTTAACGTTTCCGAAGGTAGG - Intronic
929530302 2:42746807-42746829 CGTGTAAGGTTCCTGGAGGGTGG - Intronic
929723975 2:44404084-44404106 ACTGTAAGCTTCCAGAAGGCAGG + Intronic
930029241 2:47048255-47048277 GCTGTAAGGTTCTTCAAGGTAGG + Intronic
933301917 2:80550355-80550377 CCTGTGTGGTTCCTGAAGGATGG + Intronic
935602170 2:104933872-104933894 ATTGTAAGCTTCCTGAAGGTGGG - Intergenic
935656306 2:105426597-105426619 CCTGTAATTTTGCAGAAGGTAGG - Intronic
935816670 2:106852490-106852512 CCTGTAAGGTTCCCGAAGGTGGG + Intronic
939036739 2:137141061-137141083 CCTGGAATGTTCCCCAAGGAGGG + Intronic
946185752 2:217979597-217979619 CCTATAAGGTTCCCGAAGCCTGG + Intronic
1170963793 20:21048947-21048969 CCTGTGAGCTTCCCGGAGGGCGG + Intergenic
1183395984 22:37571143-37571165 CCTGCAGGGTTCCTGAAAGTGGG + Intronic
1184361844 22:44023853-44023875 CCTCTAAGCTTCCCGTGGGTAGG + Intronic
1185338618 22:50281894-50281916 CCTGTGAAGTTCTCAAAGGTGGG + Exonic
955251835 3:57290521-57290543 CATGTAAGGTTCCAGAAATTAGG + Intronic
960088335 3:113614158-113614180 CCTGTGAGGTTACCGCAGGCTGG - Intronic
969313051 4:6365384-6365406 CCTGTAAGGTACCCGACAGTGGG + Intronic
971069334 4:23073156-23073178 CCTGTAAGTTTCCTGTAGGGTGG - Intergenic
977463123 4:97350461-97350483 TCTGCAAGATTCCCGTAGGTTGG - Intronic
981945018 4:150331308-150331330 CCTGTACGGTTCAGCAAGGTGGG + Intronic
990702773 5:58492910-58492932 GCTCTGAGGTTCTCGAAGGTTGG - Intronic
992494373 5:77278237-77278259 CCTGTTAGGTTCTGGTAGGTAGG + Intronic
999117069 5:149173549-149173571 CCTGGAAGCTTCCCTGAGGTGGG + Intronic
999180613 5:149667572-149667594 ACTGTGAGGTTCCTGAAGGAAGG + Intergenic
1000108219 5:158080904-158080926 TCTAAAAGGGTCCCGAAGGTAGG - Intergenic
1003358854 6:5404138-5404160 CCTGTAAGGTCCATGAAGGTAGG - Intronic
1003974837 6:11332670-11332692 CCTGTGAGATTCCAGAAGCTGGG + Intronic
1006242552 6:32698032-32698054 CCTGTAAGGTTCATGGAAGTGGG - Intergenic
1012401622 6:98846224-98846246 CCAGAAAAGTTCCCAAAGGTAGG + Intergenic
1016801758 6:148175928-148175950 GCTGTAAGCTTCCAGAAGGCAGG - Intergenic
1024244795 7:47461094-47461116 ACTGTAAGCTTCCCAAAGGCGGG - Intronic
1028738547 7:94246231-94246253 CCTGTAGGATTCCCACAGGTAGG - Intergenic
1030804275 7:113895089-113895111 CCTCTAATGTTCCCCAAGATGGG + Intronic
1036489232 8:9209469-9209491 ACTATAAGTTTCCCAAAGGTGGG + Intergenic
1039868339 8:41525403-41525425 ACTGTAAAGTTCAGGAAGGTGGG - Intergenic
1045295833 8:100871136-100871158 CGTGTAAGCTTCCTGAAGGCAGG - Intergenic
1057236405 9:93365420-93365442 CCTGTAAGTTTCCCATACGTTGG - Intergenic
1059659992 9:116391242-116391264 CCTGTAAGTTTCTTAAAGGTAGG - Intronic
1186863040 X:13691874-13691896 ACTGTAAGCTTCAGGAAGGTTGG - Intronic
1187888959 X:23915373-23915395 ACTGTAAGCTTCATGAAGGTAGG - Intronic
1188454137 X:30342923-30342945 CTTGTGAGGTTCCCGCTGGTGGG - Intergenic
1201729768 Y:17191243-17191265 CCTGTTAGGATCCCTAAGGGAGG + Intergenic