ID: 935818227

View in Genome Browser
Species Human (GRCh38)
Location 2:106867829-106867851
Sequence CCCGTGGAGGACTCAAAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 81}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935818223_935818227 24 Left 935818223 2:106867782-106867804 CCAACTGTGGATTAGAAGCAGCA 0: 1
1: 0
2: 1
3: 15
4: 142
Right 935818227 2:106867829-106867851 CCCGTGGAGGACTCAAAGTCAGG 0: 1
1: 0
2: 0
3: 13
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935818227 Original CRISPR CCCGTGGAGGACTCAAAGTC AGG Intronic
900983701 1:6060942-6060964 CCTGTGGAGGGCTCAAGGTCTGG - Intronic
901723630 1:11221220-11221242 CAGGTGGATCACTCAAAGTCAGG - Intronic
901821542 1:11833456-11833478 CCACTTGAAGACTCAAAGTCAGG + Intronic
902956991 1:19932184-19932206 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
903556261 1:24195836-24195858 GGCGTGGAGGACTCCAAGTGTGG + Intergenic
904242421 1:29156755-29156777 CCCGTAGGGTACCCAAAGTCTGG + Intronic
904890882 1:33778697-33778719 CCCCTGGAGAACTCAGGGTCAGG + Intronic
919886209 1:201936707-201936729 CTGGTGGATCACTCAAAGTCAGG + Intronic
1062912318 10:1219532-1219554 TCCGTGAATGACTCAAAGACCGG - Intronic
1065851857 10:29796990-29797012 CCTGTGCAGGACCCAAAGACTGG - Intergenic
1069566886 10:69469403-69469425 CAAGTCCAGGACTCAAAGTCTGG - Intronic
1069863308 10:71484556-71484578 CGCGTGCAGGACTGAGAGTCAGG + Intronic
1070578410 10:77698289-77698311 CCCGGGGTGGACTCAAACTCCGG + Intergenic
1073932898 10:108597303-108597325 GCCGTGGAGGACTTGAAGTTTGG + Intergenic
1076190414 10:128479427-128479449 CCCAAGGAGGAGTCAGAGTCTGG + Intergenic
1078840271 11:15071632-15071654 CCTGTGGCGGACTCGAAGTAAGG - Intronic
1084272437 11:68036465-68036487 TCCGTGGAGAACTCAAAGTTGGG - Exonic
1091619533 12:2075850-2075872 CCCATGGAGAACTGACAGTCAGG + Intronic
1092871560 12:12810313-12810335 CCCGTAGGGTACCCAAAGTCCGG + Intronic
1097484649 12:60180513-60180535 CTCATGGAGGACTCAAAATCGGG + Intergenic
1103943595 12:124513968-124513990 CCCGTGGAAGACACTGAGTCAGG + Intronic
1104748713 12:131224954-131224976 CCCGTGGAGACCTCAAAGGCTGG - Intergenic
1104784411 12:131440610-131440632 CCCGTGGAGACCTCAAAGGCTGG + Intergenic
1105039341 12:132949524-132949546 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1107809540 13:44187242-44187264 TCAGTGAAGGACACAAAGTCAGG + Intergenic
1117566821 14:57001810-57001832 CCCAGGGAGGACTCAATGGCAGG - Intergenic
1121652797 14:95572191-95572213 GCCATGGTGGACTGAAAGTCAGG + Intergenic
1122122999 14:99564580-99564602 CCCCTGGGGGGCTCAGAGTCAGG - Intronic
1122273115 14:100577310-100577332 CCCTTGGAGGTCTCCAGGTCGGG - Intronic
1128097419 15:64968137-64968159 CCCATGCTGGACTCAAACTCTGG - Intronic
1135226506 16:20663491-20663513 GCCGTGGAGGCTACAAAGTCCGG - Intronic
1135421323 16:22307472-22307494 CAGGTGAAGGAGTCAAAGTCTGG - Intronic
1143568007 17:7736752-7736774 CAGGTGGATTACTCAAAGTCAGG + Intronic
1144092239 17:11868575-11868597 CCAGTGGAGGACTTAGATTCCGG + Intronic
1145760920 17:27425220-27425242 CCTGTCGTGGCCTCAAAGTCAGG + Intergenic
1146160960 17:30559377-30559399 CCTGTCGTGGCCTCAAAGTCAGG + Exonic
1149846567 17:60011897-60011919 CCTGTGGTGGCCTGAAAGTCAGG - Intergenic
1150000088 17:61429958-61429980 CCAGTGGATCACTTAAAGTCAGG - Intergenic
1150084913 17:62268472-62268494 CCTGTGGTGGCCTGAAAGTCAGG - Intergenic
1151201534 17:72471296-72471318 CCCATTGAGGACTCTGAGTCAGG - Intergenic
1156229196 18:35137690-35137712 ACCGTGGAGGGCTCAGAGCCCGG + Intronic
1156369098 18:36456639-36456661 CCCGTGGGGGACACACAGGCTGG - Intronic
1157205226 18:45692142-45692164 CTCCTGGTGGACTCTAAGTCTGG - Intergenic
1161898548 19:7100454-7100476 CCCGTAGGGTACTCTAAGTCCGG + Intergenic
1163564972 19:18045681-18045703 CCCTTGTAGGACTCATGGTCTGG - Intergenic
1163858770 19:19728728-19728750 CCCGTGGAGGTCTGAAAGTTGGG - Intronic
1164590603 19:29504911-29504933 CCCCTGGGGGACTCAAGCTCAGG + Intergenic
1166897208 19:46031421-46031443 CCCGTAGGGTACCCAAAGTCCGG - Intergenic
925402628 2:3586540-3586562 CCCGTGGAGGACGCAAACTGGGG - Intergenic
934079612 2:88456576-88456598 CCCGGGCAGGTCTCAAACTCTGG + Intergenic
935818227 2:106867829-106867851 CCCGTGGAGGACTCAAAGTCAGG + Intronic
941347800 2:164391517-164391539 GCTGTGGATGACTCAAAGGCTGG - Intergenic
946035155 2:216736146-216736168 CCCATGTAGGACTCAAACTTTGG + Intergenic
948257484 2:236578546-236578568 GCCGTGGAGGACACTGAGTCAGG + Intronic
1172286436 20:33743897-33743919 CCCTTAGGGGACTCACAGTCTGG + Intronic
1172781619 20:37439931-37439953 CCCGTGGTGGGCTCAAGGTCGGG - Intergenic
1173407969 20:42783758-42783780 GCCCTTGAGGAATCAAAGTCAGG + Intronic
1174227477 20:49013811-49013833 CCCCTGGAGGAAACAAAGTCAGG - Exonic
1181634293 22:24167176-24167198 CTCCTGGAGGACACAGAGTCAGG + Exonic
1181744597 22:24947071-24947093 GCTGTGGACGTCTCAAAGTCAGG + Intergenic
1183191873 22:36326763-36326785 CCCGTGAAGGACCCAACGTGTGG + Intronic
1184138356 22:42562535-42562557 CTCGTGGAGGACGCAGAGTGGGG + Intronic
953884139 3:46706069-46706091 CCCGTGGAGGGCTGACAGGCCGG + Intronic
954249241 3:49355480-49355502 CCCAAGGGGGACTCAAAGGCTGG + Intergenic
954685809 3:52369612-52369634 CCTGAGGAGGACCCCAAGTCAGG - Intronic
956395251 3:68819043-68819065 CAGGTGGATCACTCAAAGTCAGG + Intronic
959327552 3:104956719-104956741 CCCTTGGAGGGCACAAAATCTGG - Intergenic
969647648 4:8441753-8441775 CCCGTAGGGTACTCAAAGTCCGG + Intronic
969717609 4:8875620-8875642 CCTCTGGAAGACTCAAAGCCGGG + Intergenic
971538159 4:27780551-27780573 GCTGGGGAGGACTCAAAATCAGG - Intergenic
974609947 4:64204603-64204625 GGCGTGGACGACTCAAAGTTGGG - Intergenic
975864076 4:78708062-78708084 CCCGTGCTGGTCTCAAACTCCGG + Intergenic
978448184 4:108801097-108801119 CGGGTGGAGGACCCAAGGTCAGG - Intergenic
981354962 4:143778284-143778306 CCCGTAGGGTACCCAAAGTCTGG - Intergenic
992213697 5:74505559-74505581 CCCATGGCGTACTCAAATTCAGG + Intergenic
995767113 5:115630544-115630566 CCCTTGGAGGATTCATAATCTGG + Intronic
1001567604 5:172710110-172710132 CACGTGGATCACTCAAGGTCAGG + Intergenic
1002327277 5:178418042-178418064 CCTGTGGAGGACCCAGTGTCTGG + Intronic
1002798189 6:493796-493818 CCCGAGGAGGTCTCAAAAACTGG + Intronic
1004627995 6:17394143-17394165 CCCCTGGAAGACTCACAGCCCGG - Intronic
1004638338 6:17489862-17489884 CCAGTGGAGAACTCAAGATCTGG - Intronic
1005721674 6:28608400-28608422 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1011822927 6:91273871-91273893 CCAGGGGAGGGCTCAAACTCTGG + Intergenic
1012755777 6:103228264-103228286 CCCATGGAGGACTCTATGTGGGG - Intergenic
1017604922 6:156123639-156123661 CCCATGGAGACCTCAAAGTCTGG - Intergenic
1025034868 7:55587749-55587771 CCTGTGGAGGAAGCACAGTCAGG - Intergenic
1046752272 8:117938526-117938548 ACTGTGGAGCACTCAAAGTGTGG - Intronic
1056377223 9:86026250-86026272 CCCAAGGAGGACTCAAAGTGAGG + Exonic
1056593411 9:87984170-87984192 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1060046888 9:120348646-120348668 CCCTAGGAGGTCTCAAAGTTTGG - Intergenic
1060778327 9:126392956-126392978 TCAGTGGAGGGCTCCAAGTCAGG + Intronic
1060843359 9:126813205-126813227 CACGTGGATCACTCGAAGTCAGG - Intronic
1189247438 X:39574509-39574531 CCAGTGGAGGATTCCAAGGCTGG + Intergenic
1195295217 X:103469896-103469918 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1198102661 X:133435722-133435744 TCCCTGGAGGACACAAAGGCCGG + Intergenic