ID: 935821097

View in Genome Browser
Species Human (GRCh38)
Location 2:106893634-106893656
Sequence TTGGAGACCTAGAAATATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935821097_935821101 27 Left 935821097 2:106893634-106893656 CCAGTATATTTCTAGGTCTCCAA No data
Right 935821101 2:106893684-106893706 CAAGAGTATTCTTACATGATTGG No data
935821097_935821102 28 Left 935821097 2:106893634-106893656 CCAGTATATTTCTAGGTCTCCAA No data
Right 935821102 2:106893685-106893707 AAGAGTATTCTTACATGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935821097 Original CRISPR TTGGAGACCTAGAAATATAC TGG (reversed) Intergenic
No off target data available for this crispr