ID: 935821097 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:106893634-106893656 |
| Sequence | TTGGAGACCTAGAAATATAC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 935821097_935821101 | 27 | Left | 935821097 | 2:106893634-106893656 | CCAGTATATTTCTAGGTCTCCAA | No data | ||
| Right | 935821101 | 2:106893684-106893706 | CAAGAGTATTCTTACATGATTGG | No data | ||||
| 935821097_935821102 | 28 | Left | 935821097 | 2:106893634-106893656 | CCAGTATATTTCTAGGTCTCCAA | No data | ||
| Right | 935821102 | 2:106893685-106893707 | AAGAGTATTCTTACATGATTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 935821097 | Original CRISPR | TTGGAGACCTAGAAATATAC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||