ID: 935822472

View in Genome Browser
Species Human (GRCh38)
Location 2:106908083-106908105
Sequence CTCCCTAATAGGGTCTTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935822472_935822480 16 Left 935822472 2:106908083-106908105 CCTCTGAAGACCCTATTAGGGAG No data
Right 935822480 2:106908122-106908144 TTTCAGCTTCTGGTGGCTCCAGG 0: 10
1: 97
2: 312
3: 518
4: 1127
935822472_935822476 9 Left 935822472 2:106908083-106908105 CCTCTGAAGACCCTATTAGGGAG No data
Right 935822476 2:106908115-106908137 TTGCCCCTTTCAGCTTCTGGTGG No data
935822472_935822481 26 Left 935822472 2:106908083-106908105 CCTCTGAAGACCCTATTAGGGAG No data
Right 935822481 2:106908132-106908154 TGGTGGCTCCAGGTATTCCTTGG No data
935822472_935822475 6 Left 935822472 2:106908083-106908105 CCTCTGAAGACCCTATTAGGGAG No data
Right 935822475 2:106908112-106908134 CTCTTGCCCCTTTCAGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935822472 Original CRISPR CTCCCTAATAGGGTCTTCAG AGG (reversed) Intergenic
No off target data available for this crispr