ID: 935822475

View in Genome Browser
Species Human (GRCh38)
Location 2:106908112-106908134
Sequence CTCTTGCCCCTTTCAGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935822472_935822475 6 Left 935822472 2:106908083-106908105 CCTCTGAAGACCCTATTAGGGAG No data
Right 935822475 2:106908112-106908134 CTCTTGCCCCTTTCAGCTTCTGG No data
935822474_935822475 -5 Left 935822474 2:106908094-106908116 CCTATTAGGGAGAATCTTCTCTT No data
Right 935822475 2:106908112-106908134 CTCTTGCCCCTTTCAGCTTCTGG No data
935822473_935822475 -4 Left 935822473 2:106908093-106908115 CCCTATTAGGGAGAATCTTCTCT No data
Right 935822475 2:106908112-106908134 CTCTTGCCCCTTTCAGCTTCTGG No data
935822467_935822475 9 Left 935822467 2:106908080-106908102 CCCCCTCTGAAGACCCTATTAGG No data
Right 935822475 2:106908112-106908134 CTCTTGCCCCTTTCAGCTTCTGG No data
935822469_935822475 8 Left 935822469 2:106908081-106908103 CCCCTCTGAAGACCCTATTAGGG No data
Right 935822475 2:106908112-106908134 CTCTTGCCCCTTTCAGCTTCTGG No data
935822471_935822475 7 Left 935822471 2:106908082-106908104 CCCTCTGAAGACCCTATTAGGGA No data
Right 935822475 2:106908112-106908134 CTCTTGCCCCTTTCAGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935822475 Original CRISPR CTCTTGCCCCTTTCAGCTTC TGG Intergenic
No off target data available for this crispr