ID: 935822480

View in Genome Browser
Species Human (GRCh38)
Location 2:106908122-106908144
Sequence TTTCAGCTTCTGGTGGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2064
Summary {0: 10, 1: 97, 2: 312, 3: 518, 4: 1127}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935822472_935822480 16 Left 935822472 2:106908083-106908105 CCTCTGAAGACCCTATTAGGGAG No data
Right 935822480 2:106908122-106908144 TTTCAGCTTCTGGTGGCTCCAGG 0: 10
1: 97
2: 312
3: 518
4: 1127
935822467_935822480 19 Left 935822467 2:106908080-106908102 CCCCCTCTGAAGACCCTATTAGG No data
Right 935822480 2:106908122-106908144 TTTCAGCTTCTGGTGGCTCCAGG 0: 10
1: 97
2: 312
3: 518
4: 1127
935822471_935822480 17 Left 935822471 2:106908082-106908104 CCCTCTGAAGACCCTATTAGGGA No data
Right 935822480 2:106908122-106908144 TTTCAGCTTCTGGTGGCTCCAGG 0: 10
1: 97
2: 312
3: 518
4: 1127
935822473_935822480 6 Left 935822473 2:106908093-106908115 CCCTATTAGGGAGAATCTTCTCT No data
Right 935822480 2:106908122-106908144 TTTCAGCTTCTGGTGGCTCCAGG 0: 10
1: 97
2: 312
3: 518
4: 1127
935822474_935822480 5 Left 935822474 2:106908094-106908116 CCTATTAGGGAGAATCTTCTCTT No data
Right 935822480 2:106908122-106908144 TTTCAGCTTCTGGTGGCTCCAGG 0: 10
1: 97
2: 312
3: 518
4: 1127
935822469_935822480 18 Left 935822469 2:106908081-106908103 CCCCTCTGAAGACCCTATTAGGG No data
Right 935822480 2:106908122-106908144 TTTCAGCTTCTGGTGGCTCCAGG 0: 10
1: 97
2: 312
3: 518
4: 1127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935822480 Original CRISPR TTTCAGCTTCTGGTGGCTCC AGG Intergenic
Too many off-targets to display for this crispr