ID: 935823659

View in Genome Browser
Species Human (GRCh38)
Location 2:106919445-106919467
Sequence TTGTAAATAAATCAGGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935823659_935823662 -10 Left 935823659 2:106919445-106919467 CCATTCTCCTGATTTATTTACAA No data
Right 935823662 2:106919458-106919480 TTATTTACAAATGAGGACACTGG No data
935823659_935823663 10 Left 935823659 2:106919445-106919467 CCATTCTCCTGATTTATTTACAA No data
Right 935823663 2:106919478-106919500 TGGATGATATTGTTAACCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935823659 Original CRISPR TTGTAAATAAATCAGGAGAA TGG (reversed) Intergenic
No off target data available for this crispr