ID: 935828753

View in Genome Browser
Species Human (GRCh38)
Location 2:106977290-106977312
Sequence TGTTAGTCTTAGATCTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935828748_935828753 -2 Left 935828748 2:106977269-106977291 CCCAGATTCTTCCAATCACACTG No data
Right 935828753 2:106977290-106977312 TGTTAGTCTTAGATCTTGGGAGG No data
935828749_935828753 -3 Left 935828749 2:106977270-106977292 CCAGATTCTTCCAATCACACTGT No data
Right 935828753 2:106977290-106977312 TGTTAGTCTTAGATCTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935828753 Original CRISPR TGTTAGTCTTAGATCTTGGG AGG Intergenic
No off target data available for this crispr