ID: 935832041

View in Genome Browser
Species Human (GRCh38)
Location 2:107010550-107010572
Sequence TACCCAGGAAAACGCCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935832041_935832045 13 Left 935832041 2:107010550-107010572 CCTCTGGGGCGTTTTCCTGGGTA No data
Right 935832045 2:107010586-107010608 TCAACCTCAGAGCAGCTGGAGGG No data
935832041_935832046 14 Left 935832041 2:107010550-107010572 CCTCTGGGGCGTTTTCCTGGGTA No data
Right 935832046 2:107010587-107010609 CAACCTCAGAGCAGCTGGAGGGG No data
935832041_935832044 12 Left 935832041 2:107010550-107010572 CCTCTGGGGCGTTTTCCTGGGTA No data
Right 935832044 2:107010585-107010607 TTCAACCTCAGAGCAGCTGGAGG No data
935832041_935832043 9 Left 935832041 2:107010550-107010572 CCTCTGGGGCGTTTTCCTGGGTA No data
Right 935832043 2:107010582-107010604 CACTTCAACCTCAGAGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935832041 Original CRISPR TACCCAGGAAAACGCCCCAG AGG (reversed) Intergenic
No off target data available for this crispr