ID: 935832171

View in Genome Browser
Species Human (GRCh38)
Location 2:107011598-107011620
Sequence CTCTGGTTGTGGTGGTGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935832165_935832171 25 Left 935832165 2:107011550-107011572 CCACAGGCAACTGAATCATTGGC No data
Right 935832171 2:107011598-107011620 CTCTGGTTGTGGTGGTGATATGG No data
935832168_935832171 -8 Left 935832168 2:107011583-107011605 CCAGCTAGCAGAGGTCTCTGGTT No data
Right 935832171 2:107011598-107011620 CTCTGGTTGTGGTGGTGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935832171 Original CRISPR CTCTGGTTGTGGTGGTGATA TGG Intergenic
No off target data available for this crispr