ID: 935832830 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:107018570-107018592 |
Sequence | GATAATGCACATAAGGCTCT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
935832828_935832830 | 14 | Left | 935832828 | 2:107018533-107018555 | CCTGCATGGGTTGGTGGAAGTTT | No data | ||
Right | 935832830 | 2:107018570-107018592 | GATAATGCACATAAGGCTCTTGG | No data | ||||
935832824_935832830 | 27 | Left | 935832824 | 2:107018520-107018542 | CCTGTGTAATACTCCTGCATGGG | No data | ||
Right | 935832830 | 2:107018570-107018592 | GATAATGCACATAAGGCTCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
935832830 | Original CRISPR | GATAATGCACATAAGGCTCT TGG | Intergenic | ||
No off target data available for this crispr |