ID: 935832830

View in Genome Browser
Species Human (GRCh38)
Location 2:107018570-107018592
Sequence GATAATGCACATAAGGCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935832828_935832830 14 Left 935832828 2:107018533-107018555 CCTGCATGGGTTGGTGGAAGTTT No data
Right 935832830 2:107018570-107018592 GATAATGCACATAAGGCTCTTGG No data
935832824_935832830 27 Left 935832824 2:107018520-107018542 CCTGTGTAATACTCCTGCATGGG No data
Right 935832830 2:107018570-107018592 GATAATGCACATAAGGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935832830 Original CRISPR GATAATGCACATAAGGCTCT TGG Intergenic
No off target data available for this crispr