ID: 935836053

View in Genome Browser
Species Human (GRCh38)
Location 2:107055047-107055069
Sequence TTTTTTAAAGTGATTGTCGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935836052_935836053 27 Left 935836052 2:107054997-107055019 CCATCGGTATGTATTCATGAATG No data
Right 935836053 2:107055047-107055069 TTTTTTAAAGTGATTGTCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935836053 Original CRISPR TTTTTTAAAGTGATTGTCGA TGG Intergenic
No off target data available for this crispr