ID: 935841995

View in Genome Browser
Species Human (GRCh38)
Location 2:107123550-107123572
Sequence AGCAAGGCAGGTCCCACAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935841995_935842001 -2 Left 935841995 2:107123550-107123572 CCTTCTGTGGGACCTGCCTTGCT No data
Right 935842001 2:107123571-107123593 CTGATCAGGTATTCGCCGGGAGG No data
935841995_935842005 16 Left 935841995 2:107123550-107123572 CCTTCTGTGGGACCTGCCTTGCT No data
Right 935842005 2:107123589-107123611 GGAGGAGAGGGTTGTCTGCCTGG No data
935841995_935842002 3 Left 935841995 2:107123550-107123572 CCTTCTGTGGGACCTGCCTTGCT No data
Right 935842002 2:107123576-107123598 CAGGTATTCGCCGGGAGGAGAGG No data
935841995_935842003 4 Left 935841995 2:107123550-107123572 CCTTCTGTGGGACCTGCCTTGCT No data
Right 935842003 2:107123577-107123599 AGGTATTCGCCGGGAGGAGAGGG No data
935841995_935842000 -5 Left 935841995 2:107123550-107123572 CCTTCTGTGGGACCTGCCTTGCT No data
Right 935842000 2:107123568-107123590 TTGCTGATCAGGTATTCGCCGGG No data
935841995_935841999 -6 Left 935841995 2:107123550-107123572 CCTTCTGTGGGACCTGCCTTGCT No data
Right 935841999 2:107123567-107123589 CTTGCTGATCAGGTATTCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935841995 Original CRISPR AGCAAGGCAGGTCCCACAGA AGG (reversed) Intergenic
No off target data available for this crispr