ID: 935845187

View in Genome Browser
Species Human (GRCh38)
Location 2:107158421-107158443
Sequence CAGTATGAAAAGATGGAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935845187_935845193 13 Left 935845187 2:107158421-107158443 CCCAATTCCATCTTTTCATACTG No data
Right 935845193 2:107158457-107158479 AAGTTTTTACAATGGCTTAAAGG No data
935845187_935845192 5 Left 935845187 2:107158421-107158443 CCCAATTCCATCTTTTCATACTG No data
Right 935845192 2:107158449-107158471 AAGTGTCGAAGTTTTTACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935845187 Original CRISPR CAGTATGAAAAGATGGAATT GGG (reversed) Intergenic
No off target data available for this crispr