ID: 935847132

View in Genome Browser
Species Human (GRCh38)
Location 2:107178006-107178028
Sequence GAGCTGAAATAGGAGAAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935847132_935847136 16 Left 935847132 2:107178006-107178028 CCCTGTTTCTCCTATTTCAGCTC No data
Right 935847136 2:107178045-107178067 CTAAGAGCTGTCCAGGTAAATGG No data
935847132_935847135 9 Left 935847132 2:107178006-107178028 CCCTGTTTCTCCTATTTCAGCTC No data
Right 935847135 2:107178038-107178060 ATTTCAGCTAAGAGCTGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935847132 Original CRISPR GAGCTGAAATAGGAGAAACA GGG (reversed) Intergenic
No off target data available for this crispr