ID: 935847135

View in Genome Browser
Species Human (GRCh38)
Location 2:107178038-107178060
Sequence ATTTCAGCTAAGAGCTGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935847133_935847135 8 Left 935847133 2:107178007-107178029 CCTGTTTCTCCTATTTCAGCTCT No data
Right 935847135 2:107178038-107178060 ATTTCAGCTAAGAGCTGTCCAGG No data
935847132_935847135 9 Left 935847132 2:107178006-107178028 CCCTGTTTCTCCTATTTCAGCTC No data
Right 935847135 2:107178038-107178060 ATTTCAGCTAAGAGCTGTCCAGG No data
935847134_935847135 -1 Left 935847134 2:107178016-107178038 CCTATTTCAGCTCTAGAAATATA No data
Right 935847135 2:107178038-107178060 ATTTCAGCTAAGAGCTGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935847135 Original CRISPR ATTTCAGCTAAGAGCTGTCC AGG Intergenic
No off target data available for this crispr