ID: 935847136

View in Genome Browser
Species Human (GRCh38)
Location 2:107178045-107178067
Sequence CTAAGAGCTGTCCAGGTAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935847132_935847136 16 Left 935847132 2:107178006-107178028 CCCTGTTTCTCCTATTTCAGCTC No data
Right 935847136 2:107178045-107178067 CTAAGAGCTGTCCAGGTAAATGG No data
935847134_935847136 6 Left 935847134 2:107178016-107178038 CCTATTTCAGCTCTAGAAATATA No data
Right 935847136 2:107178045-107178067 CTAAGAGCTGTCCAGGTAAATGG No data
935847133_935847136 15 Left 935847133 2:107178007-107178029 CCTGTTTCTCCTATTTCAGCTCT No data
Right 935847136 2:107178045-107178067 CTAAGAGCTGTCCAGGTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935847136 Original CRISPR CTAAGAGCTGTCCAGGTAAA TGG Intergenic
No off target data available for this crispr