ID: 935847692

View in Genome Browser
Species Human (GRCh38)
Location 2:107184706-107184728
Sequence ATCCTGTTATTGGTGATACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935847692_935847698 4 Left 935847692 2:107184706-107184728 CCCTGTATCACCAATAACAGGAT No data
Right 935847698 2:107184733-107184755 CTTTCCTCTGAATATAGGGAAGG No data
935847692_935847696 0 Left 935847692 2:107184706-107184728 CCCTGTATCACCAATAACAGGAT No data
Right 935847696 2:107184729-107184751 GTTCCTTTCCTCTGAATATAGGG No data
935847692_935847695 -1 Left 935847692 2:107184706-107184728 CCCTGTATCACCAATAACAGGAT No data
Right 935847695 2:107184728-107184750 TGTTCCTTTCCTCTGAATATAGG No data
935847692_935847700 21 Left 935847692 2:107184706-107184728 CCCTGTATCACCAATAACAGGAT No data
Right 935847700 2:107184750-107184772 GGAAGGTACCGCTTTCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935847692 Original CRISPR ATCCTGTTATTGGTGATACA GGG (reversed) Intergenic
No off target data available for this crispr