ID: 935849711

View in Genome Browser
Species Human (GRCh38)
Location 2:107205145-107205167
Sequence TTGAAGAAGAATACGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935849705_935849711 26 Left 935849705 2:107205096-107205118 CCTGGAGGGATCTTCCCTGTCAG No data
Right 935849711 2:107205145-107205167 TTGAAGAAGAATACGGAAGAAGG No data
935849706_935849711 12 Left 935849706 2:107205110-107205132 CCCTGTCAGTGTGCAAGTTTAGC No data
Right 935849711 2:107205145-107205167 TTGAAGAAGAATACGGAAGAAGG No data
935849707_935849711 11 Left 935849707 2:107205111-107205133 CCTGTCAGTGTGCAAGTTTAGCA No data
Right 935849711 2:107205145-107205167 TTGAAGAAGAATACGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935849711 Original CRISPR TTGAAGAAGAATACGGAAGA AGG Intergenic
No off target data available for this crispr