ID: 935853025

View in Genome Browser
Species Human (GRCh38)
Location 2:107243665-107243687
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935853019_935853025 30 Left 935853019 2:107243612-107243634 CCATCAGTGAGCGATACAGACTC No data
Right 935853025 2:107243665-107243687 TGGCCAATGCTGATAGTGTGGGG No data
935853021_935853025 3 Left 935853021 2:107243639-107243661 CCTTTGAGGAAATGTTTGAGATA No data
Right 935853025 2:107243665-107243687 TGGCCAATGCTGATAGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr