ID: 935853075

View in Genome Browser
Species Human (GRCh38)
Location 2:107244136-107244158
Sequence TACACTTATGCAAAGACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935853075_935853077 -8 Left 935853075 2:107244136-107244158 CCTCCTGTCTTTGCATAAGTGTA No data
Right 935853077 2:107244151-107244173 TAAGTGTATGATGTTTCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935853075 Original CRISPR TACACTTATGCAAAGACAGG AGG (reversed) Intergenic
No off target data available for this crispr