ID: 935853077

View in Genome Browser
Species Human (GRCh38)
Location 2:107244151-107244173
Sequence TAAGTGTATGATGTTTCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935853075_935853077 -8 Left 935853075 2:107244136-107244158 CCTCCTGTCTTTGCATAAGTGTA No data
Right 935853077 2:107244151-107244173 TAAGTGTATGATGTTTCATATGG No data
935853074_935853077 -7 Left 935853074 2:107244135-107244157 CCCTCCTGTCTTTGCATAAGTGT No data
Right 935853077 2:107244151-107244173 TAAGTGTATGATGTTTCATATGG No data
935853072_935853077 3 Left 935853072 2:107244125-107244147 CCTCCATTTACCCTCCTGTCTTT No data
Right 935853077 2:107244151-107244173 TAAGTGTATGATGTTTCATATGG No data
935853071_935853077 24 Left 935853071 2:107244104-107244126 CCAACTTAGGTGAGGGGTCATCC No data
Right 935853077 2:107244151-107244173 TAAGTGTATGATGTTTCATATGG No data
935853073_935853077 0 Left 935853073 2:107244128-107244150 CCATTTACCCTCCTGTCTTTGCA No data
Right 935853077 2:107244151-107244173 TAAGTGTATGATGTTTCATATGG No data
935853068_935853077 30 Left 935853068 2:107244098-107244120 CCATTCCCAACTTAGGTGAGGGG No data
Right 935853077 2:107244151-107244173 TAAGTGTATGATGTTTCATATGG No data
935853070_935853077 25 Left 935853070 2:107244103-107244125 CCCAACTTAGGTGAGGGGTCATC No data
Right 935853077 2:107244151-107244173 TAAGTGTATGATGTTTCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935853077 Original CRISPR TAAGTGTATGATGTTTCATA TGG Intergenic
No off target data available for this crispr