ID: 935858661

View in Genome Browser
Species Human (GRCh38)
Location 2:107303111-107303133
Sequence CTGGAATTGCTGATGAAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935858658_935858661 -4 Left 935858658 2:107303092-107303114 CCACACAAGTTACCATTCTCTGG No data
Right 935858661 2:107303111-107303133 CTGGAATTGCTGATGAAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935858661 Original CRISPR CTGGAATTGCTGATGAAACC TGG Intergenic
No off target data available for this crispr