ID: 935870612

View in Genome Browser
Species Human (GRCh38)
Location 2:107444458-107444480
Sequence ATGGAAATGAACTGGGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935870607_935870612 6 Left 935870607 2:107444429-107444451 CCAGAAACCTTGCTAGAACAGAC No data
Right 935870612 2:107444458-107444480 ATGGAAATGAACTGGGCTGCAGG No data
935870608_935870612 -1 Left 935870608 2:107444436-107444458 CCTTGCTAGAACAGACATTATGA No data
Right 935870612 2:107444458-107444480 ATGGAAATGAACTGGGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935870612 Original CRISPR ATGGAAATGAACTGGGCTGC AGG Intergenic
No off target data available for this crispr