ID: 935884595

View in Genome Browser
Species Human (GRCh38)
Location 2:107603178-107603200
Sequence CTAGATGGTCCCATCTAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935884595_935884603 -2 Left 935884595 2:107603178-107603200 CCCCCCTAGATGGGACCATCTAG No data
Right 935884603 2:107603199-107603221 AGTTGCAGGGAAACAAGCTCAGG 0: 11
1: 742
2: 767
3: 479
4: 453
935884595_935884604 -1 Left 935884595 2:107603178-107603200 CCCCCCTAGATGGGACCATCTAG No data
Right 935884604 2:107603200-107603222 GTTGCAGGGAAACAAGCTCAGGG 0: 11
1: 701
2: 724
3: 461
4: 571
935884595_935884606 24 Left 935884595 2:107603178-107603200 CCCCCCTAGATGGGACCATCTAG No data
Right 935884606 2:107603225-107603247 CCCACTGATTCTACACTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935884595 Original CRISPR CTAGATGGTCCCATCTAGGG GGG (reversed) Intergenic
No off target data available for this crispr